AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i254_soj_mthe_reg_100.orf -o254_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01260 198 M.thermo Motif number 1 TTTTTTAATCTGATAACTTATAACTTATCA 1 16 1 TGATAACTTA 0.997201 -183 AAAGTATATGTGATAAGTTATAAGTTATCA 1 26 0 TGATAAGTTA 0.992662 -173 AAGTTATAATTTATAACTTATAAAGTATAT 1 47 0 TTATAACTTA 0.993813 -152 AAGTTATAAATTATAACTTAGATCCAGCAG 1 58 1 TTATAACTTA 0.993813 -141 AAAGTGCTGCTGATAGATTAACGGCTGTTG 1 148 0 TGATAGATTA 0.975193 -51 ********** Masking position 5 Map Score: 11.7544 Number of sites scoring better than the average of aligned sites = 14 Number in coding regions = 5 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 ATAAACCAGAAGGGTGGCTGTGGAAAGACA 1 117 1 AGGGTGGCTG 0.996604 -82 TGATAGATTAACGGCTGTTGTTGTCTTTCC 1 138 0 ACGGCTGTTG 0.994696 -61 CAAGGAGGAAAGTGCTGCTGATAGATTAAC 1 156 0 AGTGCTGCTG 0.994917 -43 CCTTGACAGGAGGGTTCTTGTAATCGAC 1 181 1 AGGGTTCTTG 0.991819 -18 ********** Masking position 9 Map Score: 4.57518 Number of sites scoring better than the average of aligned sites = 368 Number in coding regions = 352 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 GAAATTACCTCTCCCATCTCATCACCTGCT 1 83 0 CTCCCATCTC 0.982874 -116 TTTCCACAGCCACCCTTCTGGTTTATGATT 1 113 0 CACCCTTCTG 0.997245 -86 CTATCAGCAGCACTTTCCTCCTTGACAGGA 1 162 1 CACTTTCCTC 0.972895 -37 CGATTACAAGAACCCTCCTGTCAAGGAGGA 1 177 0 AACCCTCCTG 0.993036 -22 ********** Masking position 9 Map Score: 2.60052 Number of sites scoring better than the average of aligned sites = 679 Number in coding regions = 644 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 4 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0