AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i269_hypothetical14_mthe_reg_100.orf -o269_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00591 27 M.thermo #2 RTH00127 109 M.thermo Motif number 1 GTTCTATTAATCAAGATGGTGTTTTAA 1 7 1 TTATAAGATG 0.996842 -21 GTGGGATGTGATGATGAAGCTGT 2 2 0 ATATAAGCTG 0.97739 -108 AATGGAAAGATTTATAAATATGAAAATTTGTG 2 31 0 TTATAATATG 0.992486 -79 GGAATTATGATTAATATATATGTTATCCTTAC 2 68 0 TTATTATATG 0.988595 -42 TTAATTATTTTAATATGGTTGGAATTA 2 93 0 TATTAATATG 0.944094 -17 ** ** ****** Masking position 5 Map Score: 5.58431 Number of sites scoring better than the average of aligned sites = 50 Number in coding regions = 41 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 2 ACAGCTTCATCATCACATCCCACAAATTTT 2 10 1 TCTCACATCC 0.99309 -100 TATTTATAAATCTTTCCATTCAATTGTAAGG 2 43 1 TCTTCCATTC 0.995924 -67 ATATATGTTATCCTTACAATTGAATGGAAAG 2 54 0 TCTTACAATT 0.975538 -56 ATATTAATCATAATTCCAACCATATTAAAAT 2 83 1 TATTCCAACC 0.989607 -27 ** ******** Masking position 4 Map Score: 1.77172 Number of sites scoring better than the average of aligned sites = 255 Number in coding regions = 235 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0