AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i286_hypothetical_lipid_degradation_mthe_reg_300.orf -o286_mthe_300.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01355 147 M.thermo #2 RTH00374 143 M.thermo #3 RTH01852 135 M.thermo Motif number 1 TCATGGGGTTATTACGGCAGCCTCTTCCCCT 1 16 1 ATACGGCAGC 0.98912 -132 GGTGAGCAACATCGCTGCAGCGACTCAGAGA 2 20 0 ATGCTGCAGC 0.991829 -124 CTCACCAGTAAGGCCGGCGCCAATGACTTTG 2 45 1 AGCCGGCGCC 0.990472 -99 AGGTTAATTGATGCCTGCGGAGGTTTATAA 2 124 1 ATCCTGCGGA 0.993127 -20 AAAAATCCGTATACCTGCGGCAGGTGGGACA 3 92 0 ATCCTGCGGC 0.998675 -44 ** ******** Masking position 1 Map Score: 5.11429 Number of sites scoring better than the average of aligned sites = 129 Number in coding regions = 124 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 2 GAGGCTGCCGTAATAACCCCATGAGTCCT 1 10 0 TAATAACCCC 0.843409 -138 CCTTCAAGTGTTTAATCATCGGATCCCCTA 1 44 1 TTTAATCATC 0.747977 -104 GAAAACTTTATATTATCATAAATAATCATG 1 93 1 TATTATCATA 0.697187 -55 TAGTACCAATAATTAACATGATTATTTATG 1 109 0 AATTAACATG 0.913163 -39 AATCCCAGAAATTTAACCTCAAAGTCATTG 2 65 0 ATTTAACCTC 0.923621 -79 CGCAGGCATCAATTAACCTCAAGTCAGAAT 2 113 0 AATTAACCTC 0.974533 -31 TTATAAACCTCCGCAGGCATC 2 133 0 TATAAACCTC 0.974532 -11 AGTGCTGTAATAAAAACATGAGCGTATCAG 3 29 0 TAAAAACATG 0.768683 -107 ACTTATCCCATATTAATATCTATAGTGCTG 3 52 0 TATTAATATC 0.847403 -84 ********** Masking position 5 Map Score: 4.30408 Number of sites scoring better than the average of aligned sites = 594 Number in coding regions = 500 Number in noncoding regions = 94 Number of orfs with sites within 600 bp upstream = 95 Fraction of orfs with sites within 600 bp upstream = 0.0152586 Motif number 3 CATGGGGTTATTACGGCAGCCTCTTCCCCT 1 17 1 TTACGGCAGC 0.961867 -131 GTGAGCAACATCGCTGCAGCGACTCAGAGA 2 20 0 TCGCTGCAGC 0.989524 -124 TCAAAGTCATTGGCGCCGGCCTTACTGGTG 2 47 0 TGGCGCCGGC 0.991739 -97 GGTTAATTGATGCCTGCGGAGGTTTATAA 2 125 1 TGCCTGCGGA 0.986843 -19 AAAATCCGTATACCTGCGGCAGGTGGGACA 3 92 0 TACCTGCGGC 0.993084 -44 ********** Masking position 1 Map Score: 2.67981 Number of sites scoring better than the average of aligned sites = 210 Number in coding regions = 197 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 AACATCGCTGCAGCGACTCAGAGAAATTTAA 2 13 0 CAGCGATCAG 0.993977 -131 CATCAATTAACCTCAAGTCAGAATACAGCAT 2 106 0 CCTCAATCAG 0.976207 -38 ATAAAAACATGAGCGTATCAGAATGATTCCA 3 19 0 GAGCGTTCAG 0.984461 -117 GGAAGTGGGCCAGCAATTCAG 3 125 1 CAGCAATCAG 0.994019 -11 ****** **** Masking position 8 Map Score: 2.32684 Number of sites scoring better than the average of aligned sites = 22 Number in coding regions = 20 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 TTAAACACTTGAAGGGGAAGAGGCTGCCGTA 1 28 0 GAAGGGGAAA 0.944534 -120 GTACTAAAGAGAAGGGAGCTATAAA 1 133 1 GAAGGGAGCA 0.988872 -15 GCCGGCCTTACTGGTGAGCAACATCGCTGCA 2 32 0 CTGGTGAGCA 0.948826 -112 ATACCTGCGGCAGGTGGGACATACACTTATA 3 82 0 CAGGTGGGAA 0.983873 -54 GATTTTTCCGGAAGTGGGCCAGCAATTCAG 3 116 1 GAAGTGGGCA 0.994638 -20 ********* * Masking position 11 Map Score: 0.660258 Number of sites scoring better than the average of aligned sites = 299 Number in coding regions = 280 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 6 TGATTAAACACTTGAAGGGGAAGAGGCTGC 1 32 0 CTTGAAGGGG 0.860836 -116 TCTCTGAGTCGCTGCAGCGATGTTGCTCAC 2 20 1 GCTGCAGCGA 0.960864 -124 ACCAGTAAGGCCGGCGCCAATGACTTTGAG 2 48 1 CCGGCGCCAA 0.68393 -96 TTAATTGATGCCTGCGGAGGTTTATAA 2 127 1 CCTGCGGAGG 0.676072 -17 AATCCGTATACCTGCGGCAGGTGGGACATA 3 90 0 CCTGCGGCAG 0.902285 -46 ACGGATTTTTCCGGAAGTGGGCCAGCAATT 3 113 1 CCGGAAGTGG 0.956568 -23 ********** Masking position 4 Map Score: 0.622975 Number of sites scoring better than the average of aligned sites = 1338 Number in coding regions = 1281 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 50 Fraction of orfs with sites within 600 bp upstream = 0.00803084 Motif number 7 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0