AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i294_mixed1_mthe_reg_100.orf -o294_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01701 256 M.thermo #2 RTH00023 76 M.thermo #3 RTH01292 101 M.thermo #4 RTH00823 153 M.thermo Motif number 1 ACCTTCCTTCAGTGATTTTTTTAATGTGTGTCTTT 1 17 1 AGATTTTAAT 0.990995 -240 TAATATAAACATGAAATTTTTTAATTAGTGATCCT 1 65 0 ATATTTTAAT 0.920672 -192 TGCAGAAGACATTTATATATTTATTCGCCGTCATC 1 126 1 ATATTTTATT 0.901898 -131 GTATTATAAGATTCAGCTTTTTAATAGATGACGGC 1 152 0 ATATTTTAAT 0.980617 -105 GTCAGTTAATATTAATTTAATTAATACGATTAACG 2 17 0 ATATATTAAT 0.722083 -60 CTTGATGTGCGGAGATATCTTTAATCCCCTCATGA 3 33 0 GGATTTTAAT 0.964283 -69 GATCCACAGAAGTTACAGGTTTAATGAGAGTGATT 3 75 1 AGAGTTTAAT 0.964186 -27 CCCACCCTCCAGTAAACTTTATAATCACCCCGCCC 4 60 0 AGATTATAAT 0.970706 -94 GGAGGGTGGGAGAAAAATGTATAAATGGATTCCAC 4 85 1 AGATTATAAA 0.851989 -69 ** * * ****** Masking position 5 Map Score: 9.41483 Number of sites scoring better than the average of aligned sites = 30 Number in coding regions = 10 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 2 GAAATTTTTTAATTAGTGATCCTGCTGACACACATTAAA 1 49 0 AATTATGTGC 0.988033 -208 TTTCATGTTTATATTATTTTTCCGTTAACCTAAATTTTC 1 84 1 ATTTTTGTAC 0.814631 -173 GTTAACCTAAATTTTCTTATGCAGAAGACATTTATATAT 1 107 1 ATTTATGAGC 0.961675 -150 AAAAAGCTGAATCTTATAATACTCATGACCATATATTAA 1 165 1 ATTTATCTGC 0.987894 -92 ACTCATGACCATATATTAATCTTGCTGCCTGCGCCGTAA 1 185 1 ATTTATGTGC 0.992909 -72 TGATCATGGAATATGGAGATAAGCCTGTGAA 1 236 1 ATTAATCTGG 0.921868 -21 ACCTGATCATAATTTTTGTTCATCCGGTCAGTTAATATT 2 39 0 AATTTTCGGC 0.931716 -38 ACTTCTGTGGATCTATTTATCTTGATGTGCGGAGATATC 3 49 0 ATTTATGTGG 0.987894 -53 TTTACAGTTTATTTTATCATTTTCATGAGGAGTGATTCA 4 13 0 ATTTATCTGG 0.979404 -141 AATAAACTGTAAATGTATATGGGGCGGGGTGATTATAAA 4 39 1 AATAATGGGG 0.894732 -115 AGGAAGAGTCAACTGATTTTATGGTGGACCGTT 4 131 1 AATTTTGGGC 0.95904 -23 ** * * ** * ** * Masking position 1 Map Score: 11.7769 Number of sites scoring better than the average of aligned sites = 130 Number in coding regions = 111 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 3 AGTGATTTTTTTAATGTGTGTCTTTAATGTG 1 27 1 TTAATGTGGT 0.98138 -230 ATGTGTGTCTTTAATGTGTGTCAGCAGGATC 1 40 1 TTAATGTGGT 0.98138 -217 ATTAAAAAATTTCATGTTTATATTATTTTTC 1 75 1 TTCATGTTAT 0.826134 -182 TTAATATATGGTCATGAGTATTATAAGATTC 1 173 0 GTCATGAGAT 0.929038 -84 AAGCTAACTGCTCATGAGGGGATTAAAGATA 3 22 1 CTCATGAGGG 0.970397 -80 TCTATTTATCTTGATGTGCGGAGATATCTTT 3 46 0 TTGATGTGGG 0.968055 -56 AGTTACAGGTTTAATGAGAGTGATTTT 3 85 1 TTAATGAGGT 0.98138 -17 TTTTATCATTTTCATGAGGAGTGATTCATA 4 10 0 TTCATGAGAG 0.976513 -144 ******** ** Masking position 4 Map Score: 8.60693 Number of sites scoring better than the average of aligned sites = 251 Number in coding regions = 224 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 4 CTAAATTTTCTTATGCAGAAGACATTTATA 1 113 1 TTATGCAGAA 0.910299 -144 TTTTAATAGATGACGGCGAATAAATATATA 1 139 0 TGACGGCGAA 0.961435 -118 TCTTAGAGAGTTACGGCGCAGGCAGCAAGA 1 204 0 TTACGGCGCA 0.970116 -53 AGTTCATGCTGAAGCTAACTGCT 3 4 1 TCATGCTGAA 0.934345 -98 TCCTTTCGAGTTATGGTGGAATCCATTTAT 4 105 0 TTATGGTGGA 0.985224 -49 TCAACTGATTTTATGGTGGACCGTT 4 139 1 TTATGGTGGA 0.985224 -15 ********** Masking position 3 Map Score: 3.12676 Number of sites scoring better than the average of aligned sites = 161 Number in coding regions = 148 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 5 GGTTCTACCTTCCTTCAGTGATT 1 4 1 TCTACCTTCC 0.969732 -253 CATATATTAATCTTGCTGCCTGCGCCGTAA 1 194 1 TCTTGCTGCC 0.976647 -63 TAATTTTTGTTCATCCGGTCAGTTAATATT 2 39 0 TCATCCGGTC 0.950923 -38 AACTTTATAATCACCCCGCCCCATATACAT 4 51 0 TCACCCCGCC 0.984102 -103 TATACATTTTTCTCCCACCCTCCAGTAAAC 4 78 0 TCTCCCACCC 0.966744 -76 ATCAGTTGACTCTTCCTTTCGAGTTATGGT 4 118 0 TCTTCCTTTC 0.964731 -36 ********** Masking position 1 Map Score: 1.52102 Number of sites scoring better than the average of aligned sites = 425 Number in coding regions = 405 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 6 GAGAGTTACGGCGCAGGCAGCAAGATTAAT 1 199 0 GCGCAGGCAG 0.987857 -58 CATATTCCATGATCAGGTCTTAGAGAGTTA 1 221 0 GATCAGGTCT 0.957603 -36 CAAAAATTATGATCAGGTAGATTTGAA 2 60 1 GATCAGGTAG 0.993506 -17 ATCCCCTCATGAGCAGTTAGCTTCAGCATG 3 15 0 GAGCAGTTAG 0.983488 -87 ********** Masking position 5 Map Score: 0.80709 Number of sites scoring better than the average of aligned sites = 71 Number in coding regions = 66 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 7 ********** No masking Map Score: -7.08111e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -7.08111e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -7.08111e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0