AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i316_mixed3_mthe_reg_100.orf -o316_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01836 222 M.thermo Motif number 1 ACCTATCAGATCATATTACCGGTAATGGGAACAG 1 33 0 TCATTCGGTA 0.992965 -190 CTGATAGGTTTCTTCTCACATGGAGTTCACGGTG 1 58 1 TCTTTCTGGA 0.995651 -165 TGTGAAATGTTCATGTCACCGTGAACTCCATGTG 1 74 0 TCATTCGTGA 0.996975 -149 GGTGACATGAACATTTCACATGGAGTTCACAGCG 1 88 1 ACATTCTGGA 0.99094 -135 CATATGGTGTTCATATCGCTGTGAACTCCATGTG 1 104 0 TCATTCGTGA 0.996975 -119 CCTCAGAATGTGATATGCCGGTGAAAGATATATA 1 143 1 TGATTCGTGA 0.990192 -80 GGGAAGCTACTCTTTTAACTTGGATTACATTTAA 1 194 0 TCTTTCTGGA 0.995651 -29 **** * * **** Masking position 14 Map Score: 15.6831 Number of sites scoring better than the average of aligned sites = 157 Number in coding regions = 144 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 2 CCTATCAGATCATATTACCGGTAATGGGAACA 1 34 0 CATTTACGGT 0.921613 -189 TGATAGGTTTCTTCTCACATGGAGTTCACGGT 1 59 1 CTTTCACTGG 0.994579 -164 GTGAAATGTTCATGTCACCGTGAACTCCATGT 1 75 0 CATTCACGTG 0.996754 -148 GTGACATGAACATTTCACATGGAGTTCACAGC 1 89 1 CATTCACTGG 0.998007 -134 ATATGGTGTTCATATCGCTGTGAACTCCATGT 1 105 0 CATTCGCGTG 0.987812 -118 CTTTCACCGGCATATCACATTCTGAGGTTCAT 1 138 0 CATTCACTTC 0.992555 -85 ACTTGGATTACATTTAATCTTCAGTACATGAG 1 179 0 CATTAATTTC 0.802439 -44 GGAAGCTACTCTTTTAACTTGGATTACATTTA 1 195 0 CTTTAACTGG 0.980412 -28 *** **** *** Masking position 5 Map Score: 13.85 Number of sites scoring better than the average of aligned sites = 300 Number in coding regions = 281 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 3 AAGAAACCTATCAGATCATATTACCGGTAA 1 42 0 TCAGATCATA 0.942888 -181 ATTCTGAGGTTCATCATATGGTGTTCATAT 1 122 0 TCATCATATG 0.958005 -101 ATGATGAACCTCAGAATGTGATATGCCGGT 1 135 1 TCAGAATGTG 0.984436 -88 CATTTAATCTTCAGTACATGAGTATATATA 1 171 0 TCAGTACATG 0.989502 -52 ********** Masking position 3 Map Score: 0.129167 Number of sites scoring better than the average of aligned sites = 160 Number in coding regions = 144 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 4 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0