AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i316_mixed3_mthe_reg_300.orf -o316_mthe_300.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01836 222 M.thermo Motif number 1 CTGTTCCCATTACCGGTAATATGATCTGATAGGT 1 33 1 TACCGAATGA 0.992863 -190 CACCGTGAACTCCATGTGAGAAGAAACCTATCAG 1 58 0 TCCAGAAAGA 0.995588 -165 CACATGGAGTTCACGGTGACATGAACATTTCACA 1 74 1 TCACGAATGA 0.996964 -149 CGCTGTGAACTCCATGTGAAATGTTCATGTCACC 1 88 0 TCCAGAATGT 0.990809 -135 CACATGGAGTTCACAGCGATATGAACACCATATG 1 104 1 TCACGAATGA 0.996964 -119 TATATATCTTTCACCGGCATATCACATTCTGAGG 1 143 0 TCACGAATCA 0.990051 -80 TTAAATGTAATCCAAGTTAAAAGAGTAGCTTCCC 1 194 1 TCCAGAAAGA 0.995588 -29 **** * * **** Masking position 9 Map Score: 15.6831 Number of sites scoring better than the average of aligned sites = 157 Number in coding regions = 144 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 2 TCATGTCACCGTGAACTCCATGTGAGAAGA 1 68 0 GTGAACTCCA 0.997742 -155 TCATATCGCTGTGAACTCCATGTGAAATGT 1 98 0 GTGAACTCCA 0.997742 -125 TCACAGCGATATGAACACCATATGATGAAC 1 114 1 ATGAACACCA 0.993921 -109 ACACCATATGATGAACCTCAGAATGTGATA 1 128 1 ATGAACCTCA 0.978968 -95 ATATATACTCATGTACTGAAGATTAAATGT 1 172 1 ATGTACTGAA 0.92699 -51 TGAAGATTAAATGTAATCCAAGTTAAAAGA 1 188 1 ATGTAATCCA 0.978114 -35 ********** Masking position 5 Map Score: 10.7148 Number of sites scoring better than the average of aligned sites = 204 Number in coding regions = 187 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0