AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i321_mixed6_mthe_reg_100.orf -o321_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01701 256 M.thermo #2 RTH00023 76 M.thermo #3 RTH01134 56 M.thermo #4 RTH00011 154 M.thermo Motif number 1 AAAGACACACATTAAAAAAATCACTGAAGGA 1 21 0 ATAAAAAAAT 0.970031 -236 AGGATCACTAATTAAAAAATTTCATGTTTAT 1 65 1 ATAAAAAATT 0.931761 -192 ACGGAAAAATAATATAAACATGAAATTTTTT 1 78 0 ATATAAACAT 0.811465 -179 ATGTCTTCTGCATAAGAAAATTTAGGTTAAC 1 107 0 CTAAGAAAAT 0.805567 -150 ACGGCGAATAAATATATAAATGTCTTCTGCA 1 126 0 ATATATAAAT 0.910166 -131 GCCGTCATCTATTAAAAAGCTGAATCTTATA 1 152 1 ATAAAAAGCT 0.842008 -105 AAAGCTGAATCTTATAATACTCATGACCATA 1 167 1 CTATAATACT 0.764964 -90 TACTCATGACCATATATTAATCTTGCTGCCT 1 184 1 CTATATTAAT 0.779505 -73 AATCGTATTAATTAAATTAATATTAACTGAC 2 21 1 ATAAATTAAT 0.7636 -56 TTATCACTAAAATAATCCTAAATAAT 4 6 1 ATAAAATAAT 0.938763 -149 CTAAAATAATCCTAAATAATTCTGTGTCTGA 4 17 1 CTAAATAATT 0.828895 -138 TGTCTGAAGCATTATAAAGTTATGTCCTCCA 4 41 1 ATATAAAGTT 0.759274 -114 TATCAGGAAGAGTAAAAAAATCTTCCCCTAC 4 123 0 ATAAAAAAAT 0.971611 -32 * ********* Masking position 4 Map Score: 12.2101 Number of sites scoring better than the average of aligned sites = 221 Number in coding regions = 82 Number in noncoding regions = 139 Number of orfs with sites within 600 bp upstream = 117 Fraction of orfs with sites within 600 bp upstream = 0.0187922 Motif number 2 TAATGTGTGTCAGCAGGATCACTAATTAAA 1 51 1 CAGCAGGATC 0.966861 -206 ACGGCGCAGGCAGCAAGATTAATATATGGT 1 192 0 CAGCAAGATT 0.980662 -65 AAATTATGATCAGGTAGATTTGAA 2 63 1 CAGGTAGATT 0.964973 -14 AATTCTGTGTCTGAAGCATTATAAAGTTAT 4 34 1 CTGAAGCATT 0.944285 -121 TTCCCGGCTCCTGATGGATTAACCACGATC 4 89 1 CTGATGGATT 0.986652 -66 TTTACTCTTCCTGATAGATTAACCATC 4 138 1 CTGATAGATT 0.97917 -17 ********** Masking position 8 Map Score: 4.82638 Number of sites scoring better than the average of aligned sites = 131 Number in coding regions = 109 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 3 ACACATTAAAGACACACATTAAAAAAATCA 1 29 0 GACACACATT 0.995795 -228 TGATCCTGCTGACACACATTAAAGACACAC 1 42 0 GACACACATT 0.995795 -215 TAATGCTTCAGACACAGAATTATTTAGGAT 4 25 0 GACACAGAAT 0.986482 -130 ********** Masking position 6 Map Score: 3.12687 Number of sites scoring better than the average of aligned sites = 3 Number in coding regions = 1 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 TTAATGTGTGTCAGCAGGATCACTAATTAA 1 50 1 TCAGCAGGAT 0.92783 -207 CCATATTCCATGATCAGGTCTTAGAGAGTT 1 222 0 TGATCAGGTC 0.985039 -35 TAATTTTTGTTCATCCGGTCAGTTAATATT 2 39 0 TCATCCGGTC 0.972273 -38 ACAAAAATTATGATCAGGTAGATTTGAA 2 59 1 TGATCAGGTA 0.977045 -18 CGTGGTTAATCCATCAGGAGCCGGGAAAAG 4 86 0 CCATCAGGAG 0.977377 -69 GATGGTTAATCTATCAGGAAGAGTAAAAAA 4 135 0 CTATCAGGAA 0.928249 -20 ********** Masking position 3 Map Score: 2.42286 Number of sites scoring better than the average of aligned sites = 323 Number in coding regions = 301 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 5 TTCTTATGCAGAAGACATTTATATATTTATT 1 120 1 GAAGACTTTA 0.969063 -137 CGTAACTCTCTAAGACCTGATCATGGAATAT 1 219 1 TAAGACTGAT 0.882302 -38 TTATGATCAGGTAGATTTGAA 2 66 1 GTAGATTGAA 0.898499 -11 TGGGAGGTATGTAGACGTTATCCATATCAAT 3 28 1 GTAGACTTAT 0.969065 -29 CAGCGGAGGAGAAGATCTTTTCCCGGCTCCT 4 70 1 GAAGATTTTT 0.973802 -85 CTCGGTAGGGGAAGATTTTTTTACTCTTCCT 4 119 1 GAAGATTTTT 0.973789 -36 ****** **** Masking position 5 Map Score: 2.00423 Number of sites scoring better than the average of aligned sites = 81 Number in coding regions = 64 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 6 GTTCTACCTTCCTTCAGTGATTTTTTTAAT 1 12 1 CCTTCAGTGA 0.977025 -245 CGTCTACATACCTCCCATGAATCAAGGGGC 3 15 0 CCTCCCATGA 0.978075 -42 AAAGTTATGTCCTCCAGCGGAGGAGAAGAT 4 56 1 CCTCCAGCGG 0.952081 -99 AAAATCTTCCCCTACCGAGGATCGTGGTTA 4 108 0 CCTACCGAGG 0.948864 -47 ********** Masking position 3 Map Score: 0.1697 Number of sites scoring better than the average of aligned sites = 262 Number in coding regions = 242 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 7 AAGAAAATTTAGGTTAACGGAAAAATAATA 1 95 0 AGGTTAACGG 0.960391 -162 CAGGTCTTAGAGAGTTACGGCGCAGGCAGC 1 208 0 AGAGTTACGG 0.964041 -49 TTAATTAATACGATTAACGGTCCTA 2 6 0 CGATTAACGG 0.965605 -71 AATTAAATTAATATTAACTGACCGGATGAA 2 30 1 ATATTAACTG 0.904097 -47 TCTTCCTGATAGATTAACCATC 4 143 1 AGATTAACCA 0.929688 -12 ********** Masking position 5 Map Score: 0.560262 Number of sites scoring better than the average of aligned sites = 81 Number in coding regions = 66 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 8 ********** No masking Map Score: 1.74326e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 1.74326e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: 1.74326e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0