AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i325_not_clear_mthe_reg_300.orf -o325_mthe_300.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00986 172 M.thermo #2 RTH01119 67 M.thermo Motif number 1 TCCGGTGCTATCCATAAATGAACTGATTAC 1 21 1 TCCATAAATG 0.956934 -152 TGATTACTGGTATATGGATGTTCATTTAAA 1 44 1 TATATGGATG 0.953022 -129 GAACTCAAAATATTTAAATGAACATCCATA 1 56 0 TATTTAAATG 0.936834 -117 TGCTTATGATTCTTTTGATGTCACACTGAA 1 107 0 TCTTTTGATG 0.965872 -66 TCTTATTAATTCTGTAGGTGGGTGCTTATG 1 129 0 TCTGTAGGTG 0.978393 -44 ATCACGATCATATATATATGGAGGAGGCCA 2 18 0 TATATATATG 0.919093 -50 GATAAATAGATCTTTAAGTGTAATGGTGGT 2 45 1 TCTTTAAGTG 0.979535 -23 ********** Masking position 5 Map Score: 7.40012 Number of sites scoring better than the average of aligned sites = 110 Number in coding regions = 85 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 2 TTAAATATTTTGAGTTCACAGAACCACTGC 1 69 1 TGAGTTCACA 0.98308 -104 ATGTCACACTGAAGTTCACATGCAGTGGTT 1 90 0 GAAGTTCACA 0.985938 -83 ATGATTCTTTTGATGTCACACTGAAGTTCA 1 102 0 TGATGTCACA 0.982719 -71 TATATATGGAGGAGGCCAAAGGATT 2 6 0 GGAGGCCAAA 0.981026 -62 ********** Masking position 3 Map Score: 2.64003 Number of sites scoring better than the average of aligned sites = 267 Number in coding regions = 256 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 3 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0