AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i342_weak3_mthe_reg_300.orf -o342_mthe_300.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01601 134 M.thermo #2 RTH01432 19 M.thermo Motif number 1 AAAAATACCTGATGATGGATC 1 1 0 GTGATGGATC 0.995827 -134 AGAATGAGCCGCGGTTTGTTGCTAAAAATAC 1 24 0 GGGTTTGTTG 0.980946 -111 GGATGGAGCAGCTGATGGTTGTGAGGAGAAT 1 50 0 GTGATGGTTG 0.998866 -85 AAAAATAGTTGGTGATGGATGGAGCAGCTGA 1 66 0 GTGATGGATG 0.998863 -69 * ********* Masking position 6 Map Score: 6.46468 Number of sites scoring better than the average of aligned sites = 107 Number in coding regions = 99 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 2 CGCGGTTTGTTGCTAAAAATACCTGATGAT 1 16 0 TGCTAAAAAT 0.993204 -119 CGGCTCATTCTCCTCACAACCATCAGCTGC 1 44 1 TCCTCACAAC 0.987307 -91 ATGGGGCTATTGCTAAAAATAGTTGGTGAT 1 81 0 TGCTAAAAAT 0.993204 -54 GATGTCACCCTAAAAACTGAAGTCCAA 1 118 0 CCCTAAAAAC 0.992515 -17 ********** Masking position 6 Map Score: 4.98741 Number of sites scoring better than the average of aligned sites = 38 Number in coding regions = 33 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 3 TAGCAACAAACCGCGGCTCATTCTCCTCACAA 1 31 1 CGCGCTCATT 0.988426 -104 TCACAACCATCAGCTGCTCCATCCATCACCAA 1 57 1 CGCGCTCCAT 0.998278 -78 CTATTTTTAGCAATAGCCCCATATTAATATTG 1 89 1 CATGCCCCAT 0.989022 -46 ACCCTAAAAACTGAAGTCCAATATTAATATGG 1 107 0 CGAGTCCAAT 0.986065 -28 TTTGCCTCCCGTCTCATTG 2 3 0 CCCGTCTCAT 0.97844 -17 * ** ******* Masking position 12 Map Score: 2.39524 Number of sites scoring better than the average of aligned sites = 485 Number in coding regions = 450 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 4 TAGCAACAAACCGCGGCTCATTCTCCTCAC 1 31 1 CCGCGGCTCA 0.999134 -104 TCACAACCATCAGCTGCTCCATCCATCACC 1 57 1 CAGCTGCTCC 0.992391 -78 TTTGCCTCCCGTCTCATTG 2 4 0 TCCCGTCTCA 0.988279 -16 ********** Masking position 8 Map Score: 0.773343 Number of sites scoring better than the average of aligned sites = 73 Number in coding regions = 69 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 5 ********** No masking Map Score: -1.53887e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.53887e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.53887e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0