AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i015_Glycolysis_2_tpal_reg_100.orf -o015_tpal_100.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00425 101 AE000520 Motif number 1 TCTCTATTCAGCTGGAGCGCTCGGTCGTAG 1 35 0 GCTGGAGCGC 0.997515 -67 TAGAGATCTGGCTGATGCTCGCCGGGGCAG 1 59 1 GCTGATGCTC 0.99557 -43 GCTGATGCTCGCCGGGGCAGGGAGCGGGTG 1 69 1 GCCGGGGCAG 0.997728 -33 GGGGCAGGGAGCGGGTGCTGAGGTACGTGT 1 82 1 GCGGGTGCTG 0.998806 -20 ********** Masking position 4 Map Score: 6.75632 Number of sites scoring better than the average of aligned sites = 251 Number in coding regions = 228 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 2 GGACTATCGCTATGCGTTAC 1 1 1 GGACTATCGC 0.976071 -101 CTCGGTCGTAGGCCTGTAACGCATAGCGAT 1 16 0 GGCCTGTAAC 0.981635 -86 ACAGGCCTACGACCGAGCGCTCCAGCTGAA 1 29 1 GACCGAGCGC 0.985147 -73 GCGAGCATCAGCCAGATCTCTATTCAGCTG 1 51 0 GCCAGATCTC 0.96477 -51 TGCTCGCCGGGGCAGGGAGCGGGTGCTGAG 1 74 1 GGCAGGGAGC 0.995384 -28 ********** Masking position 1 Map Score: 4.42113 Number of sites scoring better than the average of aligned sites = 497 Number in coding regions = 449 Number in noncoding regions = 48 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 3 GGCCTGTAACGCATAGCGATAGTCC 1 6 0 GCATAGCGAT 0.996276 -96 CAGGCCTACGACCGAGCGCTCCAGCTGAAT 1 30 1 ACCGAGCGCT 0.987498 -72 CGCTCCAGCTGAATAGAGATCTGGCTGATG 1 46 1 GAATAGAGAT 0.977574 -56 GCTCGCCGGGGCAGGGAGCGGGTGCTGAGG 1 75 1 GCAGGGAGCG 0.993035 -27 ********** Masking position 6 Map Score: 1.91904 Number of sites scoring better than the average of aligned sites = 603 Number in coding regions = 568 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0