AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i033_Pyruvate_Synthase_1_tpal_reg_300.orf -o033_tpal_300.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00331 75 AE000520 #2 RTP00330 224 AE000520 Motif number 1 AAGCACTGGATGGGCTAGGGGGTTTCATCGCCT 1 24 1 TGGGTGGGGT 0.995557 -52 AGAGTTTGATTGGGTTTGGTAGGCGATGAAACC 1 44 0 TGGGTGGAGG 0.996411 -32 TAGTGGCGAGCGAAATTGGAGGAGCCTAAACCT 2 66 1 CGAATGGGGA 0.923261 -159 TGTGTCTAACAGGGGTTGTAGGGCCGCGCGGGC 2 98 1 AGGGTGTGGG 0.982793 -127 CGCGCGGGCTTGCGTTCGGTGGGTGAAATAATC 2 122 1 TGCGTGGGGG 0.99868 -103 AAAACCTTTCTGCTATAGGCCGGATTATTTCAC 2 144 0 TGCTTGGCGG 0.986968 -81 TCCCCGTATGCGGAATGGGGCGGACCTGCTGG 2 203 1 CGGATGGCGG 0.995305 -22 **** * ** *** Masking position 6 Map Score: 8.62306 Number of sites scoring better than the average of aligned sites = 147 Number in coding regions = 121 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 TGGTAGGCGATGAAACCCCCTAGCCCATCC 1 31 0 TGAAACCCCC 0.97591 -45 AATCAAACTCTGAATGCCGG 1 66 1 TGAATGCCGG 0.950579 -10 CACTACTTTCGGAATCTCTCTTGATTTCTT 2 41 0 GGAATCTCTC 0.839921 -184 AACAGGGGTTGTAGGGCCGCGCGGGCTTGC 2 105 1 GTAGGGCCGC 0.964685 -120 CCCACCGAACGCAAGCCCGCGCGGCCCTAC 2 115 0 GCAAGCCCGC 0.985415 -110 AAAGGTTTTGGGAAAGCCTGACAGAGAGGG 2 168 1 GGAAAGCCTG 0.959718 -57 ACAGAGAGGGTGAAATCCCCGTATGCGGAA 2 188 1 TGAAATCCCC 0.947491 -37 CCAGCAGGTCCGCCCCATTCCGC 2 212 0 GCAGGTCCGC 0.93387 -13 ********** Masking position 3 Map Score: 5.14549 Number of sites scoring better than the average of aligned sites = 722 Number in coding regions = 663 Number in noncoding regions = 59 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 3 CAGTGCTTTACCTCCGACAGT 1 2 0 CCTCCGACAG 0.993465 -74 ACCCAATCAAACTCTGAATGCCGG 1 62 1 ACTCTGAATG 0.956399 -14 ATCAAGAGAGATTCCGAAAGTAGTGGCGAG 2 46 1 ATTCCGAAAG 0.915283 -179 GGCCCTACAACCCCTGTTAGACACAGGTTT 2 93 0 CCCCTGTTAG 0.946934 -132 ATTATTTCACCCACCGAACGCAAGCCCGCG 2 124 0 CCACCGAACG 0.962835 -101 GATTTCACCCTCTCTGTCAGGCTTTCCCAA 2 175 0 TCTCTGTCAG 0.963042 -50 GAGGGTGAAATCCCCGTATGCGGAATGGGG 2 193 1 TCCCCGTATG 0.966492 -32 ********** Masking position 6 Map Score: 4.555 Number of sites scoring better than the average of aligned sites = 438 Number in coding regions = 400 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 4 AGGGGGTTTCATCGCCTACCAAACCCAATC 1 40 1 ATCGCCTACC 0.980414 -36 CTCCTCCAATTTCGCTCGCCACTACTTTCG 2 60 0 TTCGCTCGCC 0.990662 -165 GCCGGATTATTTCACCCACCGAACGCAAGC 2 129 0 TTCACCCACC 0.996931 -96 ATACGGGGATTTCACCCTCTCTGTCAGGCT 2 182 0 TTCACCCTCT 0.978892 -43 ********** Masking position 2 Map Score: 2.37516 Number of sites scoring better than the average of aligned sites = 95 Number in coding regions = 79 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 5 TCCGAAAGTAGTGGCGAGCGAAATTGGAGG 2 58 1 GTGGCGAGCG 0.995287 -167 AGGGGTTGTAGGGCCGCGCGGGCTTGCGTT 2 108 1 GGGCCGCGCG 0.867737 -117 TATGCGGAATGGGGCGGACCTGCTGG 2 209 1 GGGGCGGACC 0.615929 -16 ********** Masking position 5 Map Score: 0.305521 Number of sites scoring better than the average of aligned sites = 70 Number in coding regions = 57 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 6 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0