AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i132_Transmembrane_Transport_6_tpal_reg_300.orf -o132_tpal_300.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00337 109 AE000520 Motif number 1 CAAAGTTTCGTAGGGAGTGCGTTGCCGAGT 1 16 1 TAGGGAGTGC 0.994027 -94 CGAGTTCAGGAGGGTGGTGTGGCCTGCGCG 1 41 1 AGGGTGGTGT 0.979727 -69 CGCGGTATGTACCTGAGTGCGCGCAGGCCA 1 60 0 ACCTGAGTGC 0.978759 -50 TACCGCGGTTAAGGTAGTGCTCGTCTCTAC 1 83 1 AAGGTAGTGC 0.998029 -27 GACAACGGTAGAGACGAGCACTAC 1 96 0 ACGGTAGAGA 0.983292 -14 ********** Masking position 7 Map Score: 5.06719 Number of sites scoring better than the average of aligned sites = 401 Number in coding regions = 355 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 44 Fraction of orfs with sites within 600 bp upstream = 0.00706714 Motif number 2 CCACCCTCCTGAACTCGGCAACGCACTCCC 1 28 0 GAACTCGGCA 0.991832 -82 GCACTACCTTAACCGCGGTATGTACCTGAG 1 73 0 AACCGCGGTA 0.535073 -37 GACAACGGTAGAGACGAGCA 1 100 0 GACAACGGTA 0.973265 -10 ********** Masking position 2 Map Score: 1.52442 Number of sites scoring better than the average of aligned sites = 34 Number in coding regions = 33 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 3 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0