AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i149_Thioredoxin_tpal_reg_300.orf -o149_tpal_300.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00970 222 AE000520 Motif number 1 GCGGGGTATTTTTCTCTCGTTCCAAA 1 5 0 TTCTCCGTTC 0.972721 -218 AGAGAAAAATACCCCGCCGAGCGCGCTCGTAC 1 20 1 ACCCGCGAGC 0.996556 -203 GGGCAGTGTATCAACGACGTGCCTGTGTACGA 1 46 0 TCACGCGTGC 0.992747 -177 GAAAATAAATTTCCCCACGTTCGATAGTGCAG 1 80 1 TTCCCCGTTC 0.996376 -143 GCAGTGGGGATTTCCCACGATGGTGCCTGCAA 1 108 1 TTCCCCGATG 0.988899 -115 GTTCGGTCCCATGACGGCGTGCACCTCGCCGG 1 159 1 ATACGCGTGC 0.99364 -64 CTAACCCTGAATACCGGCGAGGTGCACGCCGT 1 172 0 ATCCGCGAGG 0.994604 -51 ** *** ***** Masking position 8 Map Score: 10.7133 Number of sites scoring better than the average of aligned sites = 367 Number in coding regions = 342 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 2 ACGACGTGCCTGTGTACGAGCGCGCTCGGCGG 1 33 0 TGTGACAGCG 0.992092 -190 TTTCAAGGGCAGTGTATCAACGACGTGCCTGT 1 52 0 AGTGATAACG 0.964638 -171 GATAGTGCAGTGGGGATTTCCCACGATGGTGC 1 102 1 TGGGATTCCC 0.983829 -121 TGCCTGCAAGAGTGGACTTGCCTGCACCGTTC 1 131 1 AGTGACTGCC 0.972342 -92 CACGCCGTCATGGGACCGAACGGTGCAGGCAA 1 148 0 TGGGCCAACG 0.99063 -75 CTTTTGAGGATGGGCCTATCCG 1 211 1 TGGGCTTCCG 0.990372 -12 **** ** **** Masking position 4 Map Score: 3.19474 Number of sites scoring better than the average of aligned sites = 271 Number in coding regions = 256 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 3 CACGTCGTTGATACACTGCCCTTGAAAATA 1 57 1 ATACACTGCC 0.958628 -166 GAAATCCCCACTGCACTATCGAACGTGGGG 1 92 0 CTGCACTATC 0.993669 -131 CCACTCTTGCAGGCACCATCGTGGGAAATC 1 116 0 AGGCACCATC 0.989254 -107 GTGGACTTGCCTGCACCGTTCGGTCCCATG 1 142 1 CTGCACCGTT 0.98953 -81 ********** Masking position 5 Map Score: 0.704272 Number of sites scoring better than the average of aligned sites = 372 Number in coding regions = 339 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 4 GAACGAGAGAAAAATACCCCGCCGAGCGCG 1 15 1 AAAATACCCC 0.993286 -208 CCTTGAAAATAAATTTCCCCACGTTCGATA 1 76 1 AAATTTCCCC 0.988223 -147 CAAAAGTCTCAACCTAACCCTGAATACCGG 1 187 0 AACCTAACCC 0.985415 -36 ********** Masking position 2 Map Score: 0.335022 Number of sites scoring better than the average of aligned sites = 35 Number in coding regions = 33 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0