AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i183_thiamin_biosynthesis_tpal_reg_300.orf -o183_tpal_300.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00433 150 AE000520 Motif number 1 CAATTGCACAGCCACCTGGAAGTATCGTCC 1 34 0 GCCACCTGGA 0.973696 -117 TACGACCTGCACCATCTGGATACAATTGCA 1 56 0 ACCATCTGGA 0.967793 -95 TACTGCATGCACCACCGGTGTCTTACGACC 1 79 0 ACCACCGGTG 0.996258 -72 AGCGTCCTTTGCCCCCGGGGCGTCTTTTTG 1 131 1 GCCCCCGGGG 0.976249 -20 ********** Masking position 6 Map Score: 7.37294 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 39 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 TCCAATCCGCTGAGCGGCTGGC 1 1 0 TGGCGGCTGC 0.993736 -150 GTATCCAGATGGTGCAGGTCGTAAGACACCGG 1 63 1 GGGCAGGTGT 0.995812 -88 AGACACCGGTGGTGCATGCAGTAACCGTTGAT 1 86 1 GGGCATGCGT 0.982181 -65 ATGAGCAAGATGAGCGTCCTTTGCCCCCGGGG 1 119 1 TGGCGTCCTT 0.993636 -32 CTTTGCCCCCGGGGCGTCTTTTTG 1 137 1 GGGCGTCTTT 0.996943 -14 ** ****** ** Masking position 5 Map Score: 4.84623 Number of sites scoring better than the average of aligned sites = 320 Number in coding regions = 297 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 3 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0