AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i225_Glutamyl_tRNA_synthase_tpal_reg_100.orf -o225_tpal_100.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00776 171 AE000520 #2 RTP00777 21 AE000520 Motif number 1 ACCGCGCACAGCCCCCACACCAGCGCGCGC 1 11 1 GCCCCCACAC 0.993952 -161 CCACACCAGCGCGCGCGTACCCTGCCGAAT 1 25 1 GCGCGCGTAC 0.957215 -147 AATACTCTCTTCCCCCATACTCGCCCCGAC 1 52 1 TCCCCCATAC 0.991572 -120 TCCCCCATACTCGCCCCGACAACCTGCTGA 1 62 1 TCGCCCCGAC 0.996185 -110 GCGCTGCGCAGCGCCTGGTTAAACGTTGCG 1 106 0 GCGCCTGGTT 0.947902 -66 TTCAGATTTTGCGCCTCTTCTGCACTGAAT 1 140 1 GCGCCTCTTC 0.988937 -32 CGCCCCCAGGCTAGCGCAAAA 2 2 1 GCCCCCAGGC 0.942279 -20 ********** Masking position 4 Map Score: 11.78 Number of sites scoring better than the average of aligned sites = 539 Number in coding regions = 483 Number in noncoding regions = 56 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 2 ACCGCGCACAGCCCCCACACC 1 2 1 CCGCGCACAG 0.947964 -170 TTTCTATTTCAAGCGCAACGTTTAACCAGG 1 93 1 AAGCGCAACG 0.992937 -79 TAACCAGGCGCTGCGCAGCGCGGTTTTCAG 1 115 1 CTGCGCAGCG 0.9636 -57 AGTGCAGAAGAGGCGCAAAATCTGAAAACC 1 136 0 AGGCGCAAAA 0.984469 -36 TCAGTGGATTCAGTGCAGAAGAGGCGCAAA 1 147 0 CAGTGCAGAA 0.968922 -25 GCCCCCAGGCTAGCGCAAAA 2 12 1 TAGCGCAAAA 0.983972 -10 ********** Masking position 7 Map Score: 8.21945 Number of sites scoring better than the average of aligned sites = 735 Number in coding regions = 695 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 3 CGCACAGCCCCCACACCAGCGCGCGCGTACCC 1 15 1 CCCACAGCGC 0.996771 -157 GAGTATTCGGCAGGGTACGCGCGCGCTGGTGT 1 27 0 CAGGTCGCGC 0.789718 -145 TACTCTCTTCCCCCATACTCGCCCCGACAACC 1 54 1 CCCATCTCGC 0.95712 -118 CCATACTCGCCCCGACAACCTGCTGATTTTCT 1 66 1 CCGACACCTG 0.92422 -106 TGAAAACCGCGCTGCGCAGCGCCTGGTTAAAC 1 112 0 GCGCGAGCGC 0.971309 -60 AGGCGCAAAATCTGAAAACCGCGCTGCGCAGC 1 124 0 TCGAAACCGC 0.950326 -48 CGCCCCCAGGCTAGCGCAAAA 2 6 1 CCGGCAGCGC 0.995792 -16 ** *** ***** Masking position 10 Map Score: 2.71951 Number of sites scoring better than the average of aligned sites = 1259 Number in coding regions = 1152 Number in noncoding regions = 107 Number of orfs with sites within 600 bp upstream = 83 Fraction of orfs with sites within 600 bp upstream = 0.0133312 Motif number 4 ********** No masking Map Score: 4.00336e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 4.00336e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 4.00336e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0