AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i228_6_1_1_17_tpal_reg_100.orf -o228_tpal_100.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00558 177 AE000520 Motif number 1 GATTTTGTCGTGGGTGCGCGCCCT 1 5 0 TGGGTGCGCG 0.995094 -173 TACTCCACGAATCGAACGCGTGCCAGTGCG 1 43 1 ATCGAACGCG 0.964041 -135 ATCGAACGCGTGCCAGTGCGGTACACTGCG 1 53 1 TGCCAGTGCG 0.997005 -125 TTGGGGGAAGATGCAGCGCGCAGTGTACCG 1 71 0 ATGCAGCGCG 0.996741 -107 CTTCCCCCAATACCAGCGCGAGCTTGCCCT 1 91 1 TACCAGCGCG 0.996767 -87 GCTTGCCCTCAAGCTGTGCGCCATACTTTT 1 112 1 AAGCTGTGCG 0.991283 -66 GAGACGGTGCAGCATGTGCGGGAAAAGTAT 1 134 0 AGCATGTGCG 0.983268 -44 ********** Masking position 8 Map Score: 15.3273 Number of sites scoring better than the average of aligned sites = 1027 Number in coding regions = 954 Number in noncoding regions = 73 Number of orfs with sites within 600 bp upstream = 68 Fraction of orfs with sites within 600 bp upstream = 0.0109219 Motif number 2 TTGATTTTGTCGTGGGTGCGCGCCCT 1 7 0 CGTGGGTGCG 0.990116 -171 TCGCGCTGGTATTGGGGGAAGATGCAGCGC 1 82 0 ATTGGGGGAA 0.988238 -96 TGGCGCACAGCTTGAGGGCAAGCTCGCGCT 1 105 0 CTTGAGGGCA 0.992361 -73 CGGTGCAGCATGTGCGGGAAAAGTATGGCG 1 130 0 TGTGCGGGAA 0.985869 -48 CGTGGGGGTATTTCGTATAC 1 168 0 CGTGGGGGTA 0.997661 -10 ********** Masking position 3 Map Score: 6.90962 Number of sites scoring better than the average of aligned sites = 224 Number in coding regions = 200 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 3 GCGTTCGATTCGTGGAGTACACACGTTGAT 1 32 0 CGTGGAGTAC 0.99024 -146 AGATGCAGCGCGCAGTGTACCGCACTGGCA 1 63 0 CGCAGTGTAC 0.99828 -115 GCACCGTCTCGGCAGTATACGAAATACCCC 1 154 1 GGCAGTATAC 0.991427 -24 ********** Masking position 9 Map Score: 1.29991 Number of sites scoring better than the average of aligned sites = 86 Number in coding regions = 82 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 4 TGATTTTGTCGTGGGTGCGCGCCCT 1 6 0 GTGGGTGCGC 0.985729 -172 TCGAACGCGTGCCAGTGCGGTACACTGCGC 1 54 1 GCCAGTGCGG 0.994823 -124 GGTATTGGGGGAAGATGCAGCGCGCAGTGT 1 75 0 GAAGATGCAG 0.98192 -103 ATACTGCCGAGACGGTGCAGCATGTGCGGG 1 142 0 GACGGTGCAG 0.998304 -36 ********** Masking position 6 Map Score: 2.90258 Number of sites scoring better than the average of aligned sites = 312 Number in coding regions = 285 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 5 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0