AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i243_regulatory_tpal_reg_300.orf -o243_tpal_300.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00740 47 AE000520 #2 RTP00743 169 AE000520 Motif number 1 GCTGCACCTCGCGCTCGAGGCG 1 1 0 GCCTCGAGCG 0.99767 -47 AGCGCGAGGTGCAGCCGAGGCGCCGCTGCCAC 1 18 1 GCGCCGAGCG 0.999328 -30 CTGCGCCAGTGGCAGCGGCGCCTC 1 34 0 GCCCAGTGCA 0.991827 -14 GTACATACCAGATGCCGTCGCGGGAGGACAGG 2 50 0 GAGCCGTGCG 0.999006 -120 AGTCGCAGATGATCCCGTTTCGGTGAATCTGG 2 130 1 GACCCGTTCG 0.996455 -40 ** ***** *** Masking position 7 Map Score: 8.55033 Number of sites scoring better than the average of aligned sites = 181 Number in coding regions = 171 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 ATCGTGTACATACCAGATGCCGTCGCGGGA 2 57 0 TACCAGATGC 0.997629 -113 ATCATTCTGTTCCCAAATTCTCAACTACGT 2 88 0 TCCCAAATTC 0.990647 -82 GCACTTTTAGTCGCAGATGATCCCGTTTCG 2 122 1 TCGCAGATGA 0.983893 -48 GGTTTTCAAATACCAGATTCACCGAAACGG 2 144 0 TACCAGATTC 0.996338 -26 ********** Masking position 5 Map Score: 5.46638 Number of sites scoring better than the average of aligned sites = 48 Number in coding regions = 46 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 3 CTCGAGCGCGAGGTGCAGCCGAGGCGCCGC 1 14 1 AGGTGCAGCC 0.981855 -34 GGTGCAGCCGAGGCGCCGCTGCCACTGGCG 1 25 1 AGGCGCCGCT 0.994415 -23 GTGATAGGTAAAGCGCTTCTTTTCCCGGAA 2 21 0 AAGCGCTTCT 0.927765 -149 TGTACATACCAGATGCCGTCGCGGGAGGAC 2 53 0 AGATGCCGTC 0.973457 -117 CTGCGACTAAAAGTGCCTTCATCATTCTGT 2 108 0 AAGTGCCTTC 0.960651 -62 AGGCACTTTTAGTCGCAGATGATCCCGTTT 2 120 1 AGTCGCAGAT 0.911729 -50 ********** Masking position 1 Map Score: 4.95724 Number of sites scoring better than the average of aligned sites = 800 Number in coding regions = 726 Number in noncoding regions = 74 Number of orfs with sites within 600 bp upstream = 52 Fraction of orfs with sites within 600 bp upstream = 0.00835207 Motif number 4 GGTAAAGCGCTTCTTTTCCCGGAAATCCCG 2 15 0 TTCTTTTCCC 0.996634 -155 GCCTTCATCATTCTGTTCCCAAATTCTCAA 2 94 0 TTCTGTTCCC 0.997727 -76 ********** Masking position 6 Map Score: 1.30601 Number of sites scoring better than the average of aligned sites = 5 Number in coding regions = 4 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 ********** No masking Map Score: 2.93755e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.93755e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.93755e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0