AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i254_soj_tpal_reg_100.orf -o254_tpal_100.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00369 300 AE000520 #2 RTP00372 39 AE000520 #3 RTP00841 132 AE000520 #4 RTP00712 151 AE000520 Motif number 1 GTGAAGCGTGCAATACACCGGCGTAGTCT 1 6 0 CACACGGCGT 0.838398 -295 AATCGTCACAGAAATCCCCACTGCCACACCAAAA 1 67 1 GACCCACTGC 0.907275 -234 CCGCCACTGAGTACGAAGGAGCGCGCGATAGTTT 1 99 0 GTAAGAGCGC 0.905381 -202 CGTACTCAGTGGCGGTAGCTCCGCGCCAGGAATA 1 118 1 GGTACTCCGC 0.879812 -183 CTCCGCGCCAGGAATAATCAGCGCCCACCATGTC 1 136 1 GGAACAGCGC 0.996328 -165 GTGCATTCCCGATAGTAACGCTGCTCTCTTTTAT 1 218 0 GATACGCTGC 0.915134 -83 TTTTGAAGCGCTGTCCATCGGTGCATTCCCGATA 1 238 0 CTCACGGTGC 0.907998 -63 CTTCTCATAGGGGGCAAGCAGAGCACAA 2 22 1 GGAACAGAGC 0.976611 -18 CACGTTATGAGGTTACCTCGGCGCGTAGTTCCTT 3 20 1 GGCCCGGCGC 0.996295 -113 TACCACGCACAACATAATCAGCGCTAAAGGAAAT 3 66 1 AAAACAGCGC 0.935521 -67 CCCGGCCACTGATCGAAACGGCGCGCAATACCGA 4 27 0 GAAACGGCGC 0.997347 -125 ATCAGTGGCCGGGAAAAACGCAGCTCGTCATTCC 4 48 1 GGAACGCAGC 0.969659 -104 CGGGCACTCTGACGCACTCAGCGCAGTGGACACC 4 88 1 GAACCAGCGC 0.989367 -64 ACTCAGCGCAGTGGACACCGGCGCCATTTCTGAC 4 103 1 GTCACGGCGC 0.99564 -49 ** ** ****** Masking position 13 Map Score: 19.9237 Number of sites scoring better than the average of aligned sites = 1284 Number in coding regions = 1199 Number in noncoding regions = 85 Number of orfs with sites within 600 bp upstream = 74 Fraction of orfs with sites within 600 bp upstream = 0.0118856 Motif number 2 TGACGTATCGTGCAGTGAAGCGTGCAATACACCG 1 20 0 TGCGAAGCGG 0.961917 -281 CAGTGGGGATTTCTGTGACGATTGGATTAATTGA 1 56 0 TTCGACGATG 0.957653 -245 CCACTGAGTACGAAGGAGCGCGCGATAGTTTTTG 1 96 0 CGAGGCGCGG 0.886539 -205 CTCCTTCGTACTCAGTGGCGGTAGCTCCGCGCCA 1 112 1 CTCGGCGGTG 0.969395 -189 TCGACAAAGCCTCCGACATGGTGGGCGCTGATTA 1 150 0 CTCGATGGTG 0.97616 -151 ATACGTCTTATTCAGCAATGGTCGACAAAGCCTC 1 171 0 TTCGATGGTG 0.980371 -130 TTGTGCTCTGCTTGCCCCCTATGA 2 26 0 TTGGCTGCTG 0.876638 -14 TTAGCGCTGATTATGTTGTGCGTGGTAGCATCAT 3 59 0 TTAGGTGCGG 0.949327 -74 CTAAAGGAAATGCCGCAATGATGGCTAAACTTTT 3 89 1 TGCGATGATG 0.957654 -44 CGGCGCGCAATACCGACGTGCTCGGGGGAGAG 4 9 0 TACGGTGCTG 0.970722 -143 CGCCGGTGTCCACTGCGCTGAGTGCGTCAGAGTG 4 92 0 CACGCTGAGG 0.844102 -60 CCGGCGCCATTTCTGACAAGCGGGTGGTGGAGCG 4 120 1 TTCGAAGCGG 0.97258 -32 *** * ***** * Masking position 5 Map Score: 9.78221 Number of sites scoring better than the average of aligned sites = 1073 Number in coding regions = 991 Number in noncoding regions = 82 Number of orfs with sites within 600 bp upstream = 66 Fraction of orfs with sites within 600 bp upstream = 0.0106007 Motif number 3 ACACCAAAAACTATCGCGCGCTCCTTCGTAC 1 92 1 CATCGCGCGC 0.976331 -209 CCAGGAATAATCAGCGCCCACCATGTCGGAG 1 143 1 TAGCGCCCAC 0.944798 -158 GCAACAGGGCACGTTATGAGGT 3 2 1 CACAGGGCAC 0.956765 -131 AAAAATGATGCTACCACGCACAACATAATCA 3 55 1 CACCACGCAC 0.990833 -78 AGTCCACACTCATGCACCTGAAAAGTT 3 116 0 CCTCATGCAC 0.859144 -17 CTCTCCCCCGAGCACGTCGGTATTG 4 5 1 CCCCGAGCAC 0.984249 -147 AGCTGCGTTTTTCCCGGCCACTGATCGAAAC 4 42 0 TCCCGGCCAC 0.984196 -110 GTCATTCCCCTTTCCGGGCACTCTGACGCAC 4 74 1 TTCCGGGCAC 0.946323 -78 CGCAGCCGCTCCACCACCCGCTTGTCAGAAA 4 129 0 CACCACCCGC 0.981166 -23 CACGCAGCCGCTCCACCACCC 4 141 0 CCGCAGCCGC 0.959562 -11 * ********* Masking position 9 Map Score: 11.4583 Number of sites scoring better than the average of aligned sites = 1328 Number in coding regions = 1217 Number in noncoding regions = 111 Number of orfs with sites within 600 bp upstream = 77 Fraction of orfs with sites within 600 bp upstream = 0.0123675 Motif number 4 ********** No masking Map Score: 1.58694e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.58694e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.58694e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0