AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i255_heat_shock_tpal_reg_100.orf -o255_tpal_100.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00279 205 AE000520 #2 RTP00278 115 AE000520 Motif number 1 GGGCGTATTCCGCGCATGGATTCTGTAGAG 1 26 0 CGCGCATGGA 0.996854 -180 TAGACGTTACCGCTTTTGGTTACCAGAAAG 1 55 0 CGCTTTTGGT 0.980236 -151 AACACACAAGCGCTCATCGAGAGCACCTGC 1 125 1 CGCTCATCGA 0.950098 -81 GAGTTTGGTGCGCGTGTGCTTATCAATACA 1 161 0 CGCGTGTGCT 0.993101 -45 TACTCATTTCGGAGTTTGGTGCGCGTGTGC 1 172 0 GGAGTTTGGT 0.897308 -34 AGTGCGCGCAACGAGTTACCATGC 2 5 1 CGCGCAACGA 0.938432 -111 TGCTTATTGTGGCGCATGGTAACTCGTTGC 2 18 0 GGCGCATGGT 0.995329 -98 ATTTCCGGACAGCGTGTGCTTATTGTGGCG 2 34 0 AGCGTGTGCT 0.935787 -82 GATACCGTTGCGCGTGTGGTGCCGTATTTT 2 88 0 CGCGTGTGGT 0.998217 -28 ********** Masking position 2 Map Score: 16.1103 Number of sites scoring better than the average of aligned sites = 1134 Number in coding regions = 1056 Number in noncoding regions = 78 Number of orfs with sites within 600 bp upstream = 66 Fraction of orfs with sites within 600 bp upstream = 0.0106007 Motif number 2 CGTGTTCGCAGTCCACTCTACAGAATC 1 8 1 GCAGTCCACT 0.960307 -198 CCCTTTCTGGTAACCAAAAGCGGTAACGTC 1 53 1 TAACCAAAAG 0.840355 -153 CCTGTATTGATAAGCACACGCGCACCAAAC 1 159 1 TAAGCACACG 0.984571 -47 AAGCACACGCGCACCAAACTCCGAAATGAG 1 170 1 GCACCAAACT 0.98821 -36 GCTTTGCACTCAACTACTCATTTCG 1 191 0 GCACTCAACT 0.938972 -15 TGCGCCACAATAAGCACACGCTGTCCGGAA 2 32 1 TAAGCACACG 0.984571 -84 TCAAAATACGGCACCACACGCGCAACGGTA 2 86 1 GCACCACACG 0.997211 -30 ********** Masking position 3 Map Score: 7.64361 Number of sites scoring better than the average of aligned sites = 837 Number in coding regions = 769 Number in noncoding regions = 68 Number of orfs with sites within 600 bp upstream = 63 Fraction of orfs with sites within 600 bp upstream = 0.0101189 Motif number 3 CGCGCATGGATTCTGTAGAGTGGACTGCGAA 1 15 0 TTCTGTGAGT 0.955617 -191 CAGTGCAGCATGATGTAGACGTTACCGCTTT 1 69 0 TGATGTGACG 0.96767 -137 ATGTGCTAGTTTCTGTCGATGCAGTGCAGCA 1 90 0 TTCTGTGATG 0.992303 -116 AGCGCTTGTGTGTTTTTGATGTGCTAGTTTC 1 108 0 TGTTTTGATG 0.945181 -98 GAATTGCAGGTGCTCTCGATGAGCGCTTGTG 1 129 0 TGCTCTGATG 0.982929 -77 TGGTGCCGTATTTTGAAGAGGAAATCAAACC 2 71 0 TTTTGAGAGG 0.938421 -45 ****** **** Masking position 4 Map Score: 2.64993 Number of sites scoring better than the average of aligned sites = 170 Number in coding regions = 160 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 4 ********** No masking Map Score: -7.93376e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -7.93376e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -7.93376e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0