AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i262_3_5_1_28_tpal_reg_100.orf -o262_tpal_100.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00651 75 AE000520 #2 RTP00654 39 AE000520 Motif number 1 TCCCGTAAAACTGTGCGGTGCGCGGT 1 7 0 CTGTGCGGTG 0.992511 -69 CTACCGCATGTTCTCCCGTAAAACTGTGCG 1 20 0 TTCTCCCGTA 0.995797 -56 GACAAATAATTTCTACCGCATGTTCTCCCG 1 32 0 TTCTACCGCA 0.994046 -44 CCTGTACGGTACGCACGCCCC 1 65 0 CTGTACGGTA 0.997201 -11 TTATTTTTTCCTCTCCGGCACAGGATTTGA 2 20 1 CTCTCCGGCA 0.998787 -20 ********** Masking position 4 Map Score: 10.0243 Number of sites scoring better than the average of aligned sites = 90 Number in coding regions = 82 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 2 AAAACTGTGCGGTGCGCGGT 1 1 0 GGTGCGCGGT 0.984125 -75 ACCGCACAGTTTTACGGGAGAACATGCGGT 1 18 1 TTTACGGGAG 0.912854 -58 TTTACGGGAGAACATGCGGTAGAAATTATT 1 28 1 AACATGCGGT 0.947788 -48 GAAATTATTTGTCATGGGGGCGTGCGTACC 1 49 1 GTCATGGGGG 0.991908 -27 AGCACCGGGTTATTTTTTCC 2 1 1 AGCACCGGGT 0.991919 -39 TTTCCTCTCCGGCACAGGATTTGA 2 26 1 GGCACAGGAT 0.984098 -14 ********** Masking position 8 Map Score: 2.93001 Number of sites scoring better than the average of aligned sites = 1644 Number in coding regions = 1485 Number in noncoding regions = 159 Number of orfs with sites within 600 bp upstream = 117 Fraction of orfs with sites within 600 bp upstream = 0.0187922 Motif number 3 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0