AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i266_hypothetical11_tpal_reg_100.orf -o266_tpal_100.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RTP00977 17 AE000520 Input sequences: #1 RTP00660 78 AE000520 #2 RTP00663 29 AE000520 #3 RTP00665 147 AE000520 Motif number 1 GGCAGAACGGTGTCCTTCCCCTTG 1 2 1 GCAGACGGTC 0.998662 -77 GGATCACGGTGCAGTGCGGCGTCTGTTCCCCAC 1 50 0 GCAGGCGGTC 0.996349 -29 TTTGGCAGATCGGGATCCACATGGGAA 2 13 0 GCAGTCGGTC 0.997855 -17 TGCTTTATCCGCATCACGGGTAGGGTCTCCAAG 3 16 1 GCATACGGAG 0.973774 -132 AGCAGGGGCCGCGACACGTAGTGCTCATTAGCC 3 51 0 GCGAACGTTG 0.983893 -97 TTCCTACTCTGCGGTACATCATCGAGCAGGGGC 3 75 0 GCGGACATTC 0.982019 -73 CGTCACTGCAGCAGTTCCTACTCTGCGGTACAT 3 89 0 GCAGTCCTTC 0.97511 -59 GCAGTGACGCGCGTGTCGTCTTGCACCATACCA 3 113 1 GCGTTCGTTG 0.989713 -35 ACCGATGCGTGATGGTATGGTGCAAGACG 3 129 0 GCGTATGGTG 0.967456 -19 **** **** ** Masking position 2 Map Score: 16.58 Number of sites scoring better than the average of aligned sites = 397 Number in coding regions = 361 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 2 CAAGGGGAAGGACACCGTTCTGCC 1 5 0 GACACCGTTC 0.978428 -74 GCGGCGTCTGTTCCCCACTCAATCGGTGCG 1 38 0 TTCCCCACTC 0.960655 -41 GTGGGGAACAGACGCCGCACTGCACCGTGA 1 50 1 GACGCCGCAC 0.980858 -29 ACTGCACCGTGATCCTGTTCC 1 68 1 GATCCTGTTC 0.981106 -11 TTCCCATGTGGATCCCGATCTGCCAAA 2 13 1 GATCCCGATC 0.917962 -17 CCATCTTGGAGACCCTACCCGTGATGCGGA 3 23 0 GACCCTACCC 0.989845 -125 ACGTGTCGCGGCCCCTGCTCGATGATGTAC 3 65 1 GCCCCTGCTC 0.996549 -83 CACTGCAGCAGTTCCTACTCTGCGGTACAT 3 89 0 GTTCCTACTC 0.981731 -59 ********** Masking position 5 Map Score: 12.9121 Number of sites scoring better than the average of aligned sites = 460 Number in coding regions = 413 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 3 ATCGGTGCGATCCAAGGGGAAGGACACCGT 1 17 0 TCCAAGGGGA 0.876293 -62 GACGCCGCACTGCACCGTGATCCTGTTCC 1 60 1 TGCACCGTGA 0.961103 -19 CATTCCCATGTGGATCCCGATCT 2 4 1 TCCCATGTGG 0.890411 -26 GGGTAGGGTCTCCAAGATGGCTAATGAGCA 3 33 1 TCCAAGATGG 0.989915 -115 TCGCGGCCCCTGCTCGATGATGTACCGCAG 3 70 1 TGCTCGATGA 0.959448 -78 GATGGTATGGTGCAAGACGACACGCGCGTC 3 118 0 TGCAAGACGA 0.975195 -30 ACCGATGCGTGATGGTATGGTGCAA 3 133 0 TGCGTGATGG 0.946865 -15 ********** Masking position 1 Map Score: 4.0657 Number of sites scoring better than the average of aligned sites = 473 Number in coding regions = 434 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 4 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0