AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i296_mixed11_tpal_reg_100.orf -o296_tpal_100.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00949 206 AE000520 Motif number 1 CAAAACTCCACGACACCCGCATTGAAGTATC 1 28 1 CGACCCCGCA 0.997084 -179 CGGTGGGCGTCGACGCCGACACGTCTTGATT 1 73 0 CGACCCGACA 0.977079 -134 TCGGCGTCGACGCCCACCGCAACGAAAAAAA 1 85 1 CGCCACCGCA 0.997801 -122 GCGTTGCAAACTCTAGCCCCAGCTCCGGCCG 1 118 1 CTCTGCCCCA 0.989785 -89 CTAGCCCCAGCTCCGGCCGGAACAGCAAACT 1 130 1 CTCCGCCGGA 0.992351 -77 GGGATTAAAAAGCCTGCGGCAGGGAGTTTGC 1 154 0 AGCCGCGGCA 0.964164 -53 CAGTATGATCCGCTTGCGCCAAATAATTTGG 1 184 0 CGCTGCGCCA 0.996242 -23 **** ****** Masking position 11 Map Score: 13.4243 Number of sites scoring better than the average of aligned sites = 491 Number in coding regions = 460 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 2 ATACTTCAATGCGGGTGTCGTGGAGTTTTG 1 28 0 GCGGGTGTCG 0.990753 -179 ATCAAGACGTGTCGGCGTCGACGCCCACCG 1 74 1 GTCGGCGTCG 0.960262 -133 TTTTTTCGTTGCGGTGGGCGTCGACGCCGA 1 85 0 GCGGTGGGCG 0.991803 -122 GGCCGGAGCTGGGGCTAGAGTTTGCAACGC 1 118 0 GGGGCTAGAG 0.966917 -89 GTTTGCTGTTCCGGCCGGAGCTGGGGCTAG 1 130 0 CCGGCCGGAG 0.983848 -77 CAAACTCCCTGCCGCAGGCTTTTTAATCCC 1 155 1 GCCGCAGGCT 0.986702 -52 CAAATTATTTGGCGCAAGCGGATCATACTG 1 185 1 GGCGCAAGCG 0.987618 -22 ********** Masking position 4 Map Score: 5.99731 Number of sites scoring better than the average of aligned sites = 1455 Number in coding regions = 1328 Number in noncoding regions = 127 Number of orfs with sites within 600 bp upstream = 81 Fraction of orfs with sites within 600 bp upstream = 0.01301 Motif number 3 CCTCAATACGCAAAACTCCACGACACCCGC 1 18 1 CAAAACTCCA 0.986761 -189 AAAGGGCGTTGCAAACTCTAGCCCCAGCTC 1 113 1 GCAAACTCTA 0.986761 -94 AAACTCTAGCCCCAGCTCCGGCCGGAACAG 1 125 1 CCCAGCTCCG 0.986319 -82 GGCCGGAACAGCAAACTCCCTGCCGCAGGC 1 144 1 GCAAACTCCC 0.99591 -63 ********** Masking position 4 Map Score: 2.13082 Number of sites scoring better than the average of aligned sites = 78 Number in coding regions = 70 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 CCTTGAGCCTCAATACGCAAAA 1 2 1 CTTGAGCCCA 0.997187 -205 GCCGACACGTCTTGATTCACTGTTTGTCTCT 1 59 0 CTTGATTCCT 0.977673 -148 GCGTTGCAAACTCTAGCCCCAGCTCCGGCCG 1 118 1 CTCTAGCCCA 0.975748 -89 CCGCAGGCTTTTTAATCCCCAAATTATTTGG 1 166 1 TTTAATCCCA 0.973488 -41 CTCAGTATGATCCGCTTGCGCCAAAT 1 191 0 TATGATCCCT 0.968674 -16 ******** ** Masking position 5 Map Score: 2.14749 Number of sites scoring better than the average of aligned sites = 144 Number in coding regions = 132 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 5 ********** No masking Map Score: 1.44541e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.44541e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.44541e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0