AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i002_aful_mthe_100.orf -o002_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG23596 126 Archaeoglobus_fulgidus #2 RTH01986 43 M.thermo #3 RTH02089 56 M.thermo Motif number 1 ACCTGAAAAGGTTTTAAAGCTGACGACAAT 1 19 0 GTTTTAAAGC 0.902197 -108 GAATATTAACTTTTTCTCGCTATCGTGAAG 1 86 0 TTTTTCTCGC 0.990592 -41 AATAAATCATTTTTTATAGC 2 1 0 TTTTTATAGC 0.995237 -43 AAAAATGATTTATTCATAGCACCCCATATA 2 17 1 TATTCATAGC 0.986109 -27 TCCATTCGGTTTTTCATCGCTCGAGTTTTT 3 20 0 TTTTCATCGC 0.996052 -37 ********** Masking position 4 Map Score: 7.67063 Number of sites scoring better than the average of aligned sites = 75 Number in coding regions = 71 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 CTCACCTGAAAAGGTTTTAAAGCTGACGACA 1 21 0 AAGGTTTTAA 0.970815 -106 TTTCAGGTGAGAATTTTTAAACATAAACAAC 1 41 1 GAATTTTTAA 0.986182 -86 CTATCGTGAAGAAGTTATAGATAATGTTGTT 1 66 0 GAAGTTATGA 0.961947 -61 TATTCTTTCAGAGTTTTTGAAGTTCA 1 111 1 GAGTTTTTAA 0.99382 -16 TTCATCGCTCGAGTTTTTTGATCCTGG 3 7 0 GAGTTTTTGA 0.994272 -50 ******** ** Masking position 6 Map Score: 5.88319 Number of sites scoring better than the average of aligned sites = 203 Number in coding regions = 186 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 ********** No masking Map Score: 2.93755e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 2.93755e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.93755e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0