AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i014_aful_mthe_100.orf -o014_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG25887 68 Archaeoglobus_fulgidus #2 RTH01963 195 M.thermo Motif number 1 AAAACTTTCTGAAAATTTTAATTTACCTGCT 1 23 0 GAAAATTTTA 0.971481 -46 AAAATTTTCAGAAAGTTTTTAATTTCACCTT 1 35 1 GAAAGTTTTA 0.980115 -34 TATAATGTTTACAATTTAATT 2 1 1 TATAATGTTA 0.894406 -195 AAAGCTGTTGGATGATGTTAAACCAGTGAAA 2 32 0 GATGATGTTA 0.988674 -164 CCCACATAGTGAAGGTGTTAAATGCAGAAAG 2 59 0 GAAGGTGTTA 0.99611 -137 GGGAGTTGTTGAAGGGGTTCATGAATGAATT 2 112 0 GAAGGGGTTA 0.989433 -84 ********* * Masking position 8 Map Score: 7.17044 Number of sites scoring better than the average of aligned sites = 347 Number in coding regions = 327 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 2 AGAAAGTTTTTAATTTCACCTTCCGAATTG 1 44 1 TAATTTCACC 0.782737 -25 CACTTCAATTCGGAAGGTGA 1 59 0 CACTTCAATT 0.938963 -10 ATAATGTTTACAATTTAATTTTTCACTGGT 2 12 1 CAATTTAATT 0.913934 -184 CTGCATTTAACACCTTCACTATGTGGGGAT 2 63 1 CACCTTCACT 0.987926 -133 ATATTACAGGCAAATTCATTCATGAACCCC 2 100 1 CAAATTCATT 0.921598 -96 CATTCATGAACCCCTTCAACAACTCCCGCA 2 116 1 CCCCTTCAAC 0.948711 -80 TTTTATAATACACCTCAACCATACTATGAG 2 162 1 CACCTCAACC 0.978873 -34 TATGAGATATCCCATTAATC 2 186 1 CCCATTAATC 0.944533 -10 ********** Masking position 8 Map Score: 4.44564 Number of sites scoring better than the average of aligned sites = 1952 Number in coding regions = 1818 Number in noncoding regions = 134 Number of orfs with sites within 600 bp upstream = 98 Fraction of orfs with sites within 600 bp upstream = 0.0157404 Motif number 3 ATAGTGAAGGTGTTAAATGCAGAAAGCTGT 2 55 0 TGTTAAATGC 0.945533 -141 TGAATTTGCCTGTAATATCCAGCGCATCCC 2 88 0 TGTAATATCC 0.990883 -108 TAAAATATGCTGTGACATCCGTGCGGGAGT 2 137 0 TGTGACATCC 0.990296 -59 AGGTGTATTATAAAATATGCTGTGACATCC 2 147 0 TAAAATATGC 0.911852 -49 AACCATACTATGAGATATCCCATTAATC 2 178 1 TGAGATATCC 0.986388 -18 ********** Masking position 5 Map Score: 4.25931 Number of sites scoring better than the average of aligned sites = 98 Number in coding regions = 87 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 4 TGAAAATTTTAATTTACCTGCTCAGAATTG 1 15 0 AATTTACCTG 0.991758 -54 AAAGTTTTTAATTTCACCTTCCGAATTGAA 1 46 1 ATTTCACCTT 0.964454 -23 TTCATGAATGAATTTGCCTGTAATATCCAG 2 96 0 AATTTGCCTG 0.986036 -100 CATATTTTATAATACACCTCAACCATACTA 2 158 1 AATACACCTC 0.975728 -38 ********** Masking position 3 Map Score: 1.9322 Number of sites scoring better than the average of aligned sites = 36 Number in coding regions = 30 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 5 ********** No masking Map Score: -4.30999e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.30999e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.30999e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0