AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i020_aful_mthe_300.orf -o020_aful_mthe_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG48032 19 Archaeoglobus_fulgidus #2 RAG50014 300 Archaeoglobus_fulgidus #3 RAG46888 145 Archaeoglobus_fulgidus Motif number 1 CTTAAAGAAAAATTTAAATATCGTCAGTGA 2 13 0 AATTTAAATA 0.759559 -288 TTAAGTTTTTATCTTAAAGAAAAATTTAAA 2 25 0 ATCTTAAAGA 0.975138 -276 TTAAGATAAAAACTTAAAACTAATTTGCTT 2 38 1 AACTTAAAAC 0.967057 -263 TCAAGCTACAAACTTAAAAAGCAAATTAGT 2 56 0 AACTTAAAAA 0.972657 -245 ACGTACAGAAAAATTCAAGCTACAAACTTA 2 70 0 AAATTCAAGC 0.826763 -231 CAATGATATTACCTAAAAGAAAGAGAGAAA 2 135 1 ACCTAAAAGA 0.906343 -166 GTTTCTGACCACCTTAAAAATCTTCTGGAA 2 239 1 ACCTTAAAAA 0.959532 -62 AACAAACCTAAACTTCAAGCG 3 2 0 AACTTCAAGC 0.973537 -144 TACGAAGTGAATTTTAAAGAGAGGCAACAG 3 75 1 ATTTTAAAGA 0.892858 -71 ********** Masking position 4 Map Score: 9.50324 Number of sites scoring better than the average of aligned sites = 282 Number in coding regions = 225 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 73 Fraction of orfs with sites within 600 bp upstream = 0.011725 Motif number 2 TTTAAATATCGTCAGTGAGA 2 1 0 GTCAGTGAGA 0.965532 -300 ATCATTGTGAGCAAGTGGCAATATTGCAAT 2 112 0 GCAAGTGGCA 0.940224 -189 TTACCTAAAAGAAAGAGAGAAATCCTGATG 2 143 1 GAAAGAGAGA 0.951404 -158 TGAGTTTTTGGCAAGTAACATCAGGATTTC 2 161 0 GCAAGTAACA 0.973915 -140 TTCAGAGTTGGTAAGTGAGTTTTTGGCAAG 2 176 0 GTAAGTGAGT 0.968589 -125 ATCTAAGATTGCAAGAAATTTCAGAGTTGG 2 195 0 GCAAGAAATT 0.85418 -106 TTTTAAGGTGGTCAGAAACTGCTGCTGGAC 2 228 0 GTCAGAAACT 0.893405 -73 AAAATCTTCTGGAAGAAAGATTGATTGAAA 2 255 1 GGAAGAAAGA 0.94817 -46 ********** Masking position 4 Map Score: 4.4657 Number of sites scoring better than the average of aligned sites = 463 Number in coding regions = 426 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 3 GTTTTAAGTTTTTATCTTAAAGAAAAATTT 2 28 0 TTTATCTTAA 0.859795 -273 CGTCGGAAAATTTATATTGCAATATTGCCA 2 97 1 TTTATATTGC 0.976688 -204 GAAAAAAGATTTTATATAACAAACCTAAAC 3 19 0 TTTATATAAC 0.654934 -127 CTTCGTATGCTTTGTATTGATTAGTACGCA 3 52 0 TTTGTATTGA 0.949279 -94 TAGTATAATGTTTATATAGAGGGATTAATA 3 106 1 TTTATATAGA 0.674318 -40 ********** Masking position 5 Map Score: 2.24383 Number of sites scoring better than the average of aligned sites = 42 Number in coding regions = 26 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 4 TTTATCTTAAAGAAAAATTTAAATATCGTC 2 18 0 AGAAAAATTT 0.932808 -283 TTCCGACGTACAGAAAAATTCAAGCTACAA 2 75 0 CAGAAAAATT 0.864609 -226 TTCTGTACGTCGGAAAATTTATATTGCAAT 2 90 1 CGGAAAATTT 0.972167 -211 TCTAAGATTGCAAGAAATTTCAGAGTTGGT 2 194 0 CAAGAAATTT 0.856454 -107 ATCTTTCTTCCAGAAGATTTTTAAGGTGGT 2 246 0 CAGAAGATTT 0.982611 -55 ATCTTCTGGAAGAAAGATTGATTGAAAAAA 2 258 1 AGAAAGATTG 0.853969 -43 AAAAAAATGGAAGACGATTTGCCATCACC 2 282 1 AAGACGATTT 0.90408 -19 ACGCACGAGAAAAAAGATTTTATATAACAA 3 27 0 AAAAAGATTT 0.956976 -119 ********** Masking position 7 Map Score: 6.40208 Number of sites scoring better than the average of aligned sites = 377 Number in coding regions = 291 Number in noncoding regions = 86 Number of orfs with sites within 600 bp upstream = 112 Fraction of orfs with sites within 600 bp upstream = 0.0179891 Motif number 5 ********** No masking Map Score: -8.85746e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -8.85746e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -8.85746e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0