AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i061_aful_mthe_300.orf -o061_aful_mthe_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00475 137 M.thermo Motif number 1 TTACAATTCTCATTTAATGATAAAATATT 1 8 1 TTATTTAATG 0.995401 -130 TAGATAATTATATATTTTAAGGAGAATATTTT 1 32 0 TTTTTTAAGG 0.997292 -106 TTTTCCATGCTGTAATTTAAGGTTTCCCATTT 1 78 0 TTATTTAAGG 0.997274 -60 TGTTTTAACATGTTTTTTAATGAACAATTTTC 1 105 0 TTTTTTAATG 0.995811 -33 * * ******** Masking position 6 Map Score: 7.79341 Number of sites scoring better than the average of aligned sites = 6 Number in coding regions = 4 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 2 TTACAATTCTCATTTAATGAT 1 2 1 TACAATTCTC 0.984248 -136 CATTTAATGATAAAATATTCTCCTTAAAAT 1 21 1 TAAAATATTC 0.946501 -117 CCTTAAAATATATAATTATCTACCTGGTCT 1 42 1 TATAATTATC 0.845714 -96 TTTTTTAATGAACAATTTTCCATGCTGTAA 1 95 0 AACAATTTTC 0.948248 -43 ********** Masking position 5 Map Score: 3.91388 Number of sites scoring better than the average of aligned sites = 85 Number in coding regions = 62 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 3 ATTTCTGGAAAGACCAGGTAGATAATTATA 1 52 0 AGACCAGGTA 0.984559 -86 TGGTCTTTCCAGAAATGGGAAACCTTAAAT 1 66 1 AGAAATGGGA 0.986873 -72 GTTCATTAAAAAACATGTTAAAACAGGGGA 1 112 1 AAACATGTTA 0.850688 -26 AAACATGTTAAAACAGGGGATGTTAG 1 122 1 AAACAGGGGA 0.992967 -16 ********** Masking position 3 Map Score: 2.10443 Number of sites scoring better than the average of aligned sites = 102 Number in coding regions = 96 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 GGAGAATATTTTATCATTAAATGAGAATTG 1 14 0 TTATCATTAA 0.982799 -124 TGATAAAATATTCTCCTTAAAATATATAAT 1 28 1 TTCTCCTTAA 0.99049 -110 CATGGAAAATTGTTCATTAAAAAACATGTT 1 101 1 TGTTCATTAA 0.986766 -37 ********** Masking position 9 Map Score: 1.90134 Number of sites scoring better than the average of aligned sites = 50 Number in coding regions = 40 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 5 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0