AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i075_aful_mthe_300.orf -o075_aful_mthe_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG50348 150 Archaeoglobus_fulgidus Motif number 1 TTGCGAAAGATTTAAAACTTTTCGGTAGGAG 1 18 0 TTTAAACTTT 0.968176 -133 TTTTAAATCTTTCGCAATTTTATCTCAATTT 1 32 1 TTCGAATTTT 0.992775 -119 TTTATCTCAATTTAAGATTTTGATTTGACAT 1 50 1 TTTAGATTTT 0.968176 -101 TTTGACATACTTTGAAATTTATTTGAAAAAA 1 73 1 TTTGAATTTA 0.976955 -78 TTACTATTTTTACGAAATTTTTTCAAATAAA 1 90 0 TACGAATTTT 0.966133 -61 GGAATCCTCCTTTATAATTCTTACTATTTTT 1 110 0 TTTAAATTCT 0.985192 -41 ACCACTCATATTTGGAATCCTCCTTTATAAT 1 123 0 TTTGAATCCT 0.976896 -28 **** ****** Masking position 7 Map Score: 9.64906 Number of sites scoring better than the average of aligned sites = 248 Number in coding regions = 172 Number in noncoding regions = 76 Number of orfs with sites within 600 bp upstream = 92 Fraction of orfs with sites within 600 bp upstream = 0.0147767 Motif number 2 AATCAAAATCTTAAATTGAGATAAAATTGCGAA 1 42 0 TTATTGAATA 0.996557 -109 ATTTAAGATTTTGATTTGACATACTTTGAAATT 1 59 1 TTATTGAATA 0.996494 -92 TACTTTGAAATTTATTTGAAAAAATTTCGTAAA 1 80 1 TTATTGAAAA 0.986085 -71 ** * **** *** Masking position 9 Map Score: 2.01256 Number of sites scoring better than the average of aligned sites = 4 Number in coding regions = 2 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0