AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i077_aful_mthe_100.orf -o077_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00306 48 M.thermo #2 RTH00146 60 M.thermo #3 RTH01779 194 M.thermo Motif number 1 GTGGTCTGTCTTCACATGCAAGGGA 1 6 1 CTGTCTTCAC 0.942958 -43 CAGTCCAGTCCAGTCCAGTCCATCCTATCC 3 103 0 CAGTCCAGTC 0.998752 -92 CAGTCCAGTCCAGTCCAGTCCAGTCCAGTC 3 113 0 CAGTCCAGTC 0.998752 -82 TTTATCAGTCCAGTCCAGTCCAGTCCAGTC 3 123 0 CAGTCCAGTC 0.998752 -72 TCTGCATTCACTGTCTACTCCAGGATCTTT 3 151 0 CTGTCTACTC 0.993935 -44 ********** Masking position 4 Map Score: 12.4232 Number of sites scoring better than the average of aligned sites = 28 Number in coding regions = 25 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 2 CTTCACATGCAAGGGAGTTAAGCGTGAGGA 1 20 1 AAGGGAGTTA 0.899398 -29 GTTAAGCGTGAGGAGATGATGCC 1 36 1 AGGAGATGAT 0.970333 -13 GCATTCCTCATAGGGATTAACTCATCAGAG 2 28 1 TAGGGATTAA 0.897933 -33 CTCATCAGAGAAAGGATGATTGA 2 48 1 AAAGGATGAT 0.928681 -13 CTGTAGGTTTAAGGGAGGAATAGGATAGGA 3 81 1 AAGGGAGGAA 0.993705 -114 AGGGAGGAATAGGATAGGATGGACTGGACT 3 92 1 AGGATAGGAT 0.836689 -103 CTCGAACATGGAGAGATGAAAA 3 183 1 GAGAGATGAA 0.958579 -12 ********** Masking position 6 Map Score: 3.59339 Number of sites scoring better than the average of aligned sites = 1809 Number in coding regions = 1693 Number in noncoding regions = 116 Number of orfs with sites within 600 bp upstream = 83 Fraction of orfs with sites within 600 bp upstream = 0.0133312 Motif number 3 GGCATCATCTCCTCACGCTTAACTCCCTTG 1 29 0 CTCTCCGCTT 0.98093 -20 CACTTCTGGAGGTCCCGGCATTCC 2 3 1 CTCTGAGGTC 0.989862 -58 CAGATTTTTACTGCTGTAGGTTTAAGGGAGGA 3 68 1 CTCTGAGGTT 0.992599 -127 CATTCACTGTCTACTCCAGGATCTTTTATCAG 3 145 0 CTCTCAGGAT 0.896473 -50 TCATCTCTCCATGTTCGAGGATCTGCATTCAC 3 170 0 ATTTCAGGAT 0.674525 -25 ** *** ***** Masking position 5 Map Score: 2.17954 Number of sites scoring better than the average of aligned sites = 341 Number in coding regions = 323 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 4 TGAGTTAATCCCTATGAGGAATGCCGGGAC 2 22 0 CCTATGAGGA 0.991931 -39 AATCATCCTTTCTCTGATGAGTTAATCCCT 2 39 0 TCTCTGATGA 0.976947 -22 TTAAACTTTTCGTATGATGATGTGGGGTGC 3 36 1 CGTATGATGA 0.987632 -159 CATCTCTCCATGTTCGAGGATCTGCATTCA 3 171 0 TGTTCGAGGA 0.956588 -24 ********** Masking position 7 Map Score: 1.107 Number of sites scoring better than the average of aligned sites = 83 Number in coding regions = 80 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 ********** No masking Map Score: -2.53363e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.53363e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.53363e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0