AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i101_aful_mthe_100.orf -o101_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG50006 125 Archaeoglobus_fulgidus Motif number 1 TTTTCTTTCAATTTTTCTTCTCATAAA 1 1 1 TTCTTCATTC 0.988543 -125 TCTCATAAATTTACTGTTCTTTGTAACCTTTGGTAAC 1 29 1 TTTTTCTTTC 0.994806 -97 GATTAAAATTTTGGTTTTTGGTGTTACCAAAGGTTAC 1 51 0 TTTTTTGTTC 0.997048 -75 AACCAAAATTTTAATCTTCAGTCTGCCATTAGCACAG 1 72 1 TTTTTCGTTC 0.998687 -54 CACCTTTTTGTGTGGTGTTACTAACAACTGT 1 105 0 TTTTGTGTTC 0.99347 -21 ** * *** ** * * Masking position 7 Map Score: 5.02646 Number of sites scoring better than the average of aligned sites = 27 Number in coding regions = 21 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 2 GTGTTACCAAAGGTTACAAAGAACAGTAAA 1 38 0 AGGTTACAAA 0.987764 -88 TTGGTTTTTGGTGTTACCAAAGGTTACAAA 1 48 0 GTGTTACCAA 0.980363 -78 TTTTTGTGTGGTGTTACTAACAACTGTGCT 1 102 0 GTGTTACTAA 0.995177 -24 ********** Masking position 6 Map Score: 3.44169 Number of sites scoring better than the average of aligned sites = 10 Number in coding regions = 6 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 TTTTCTTTCAATTTTTCTTCTCATAAA 1 8 1 TCAATTTTTC 0.977799 -118 CAAAGAACAGTAAATTTATGAGAAGAAAAA 1 22 0 TAAATTTATG 0.981105 -104 GACTGAAGATTAAAATTTTGGTTTTTGGTG 1 65 0 TAAAATTTTG 0.723818 -61 ********** Masking position 4 Map Score: 1.21511 Number of sites scoring better than the average of aligned sites = 49 Number in coding regions = 33 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 4 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0