AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i119_aful_mthe_100.orf -o119_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG47245 31 Archaeoglobus_fulgidus #2 RAG47166 300 Archaeoglobus_fulgidus #3 RTH00269 18 M.thermo #4 RTH00068 49 M.thermo #5 RTH00701 136 M.thermo Motif number 1 AGTGGAAAATGTCCTTAAAAGCGACTTTGG 2 80 1 GTCCTTAAAA 0.951652 -221 AAGCGACTTTGGTTTTTGAAAATCTAAAAA 2 98 1 GGTTTTTGAA 0.784397 -203 TCTAAAAACTGTCCTTTTAAAACTAAAATC 2 120 1 GTCCTTTTAA 0.913439 -181 CATTATCCAAGGTCTGATAAATTTTTGAAA 2 149 1 GGTCTGATAA 0.954966 -152 AAAAAGTCGGGGTCTTAAAAATAAAGTAGT 4 24 0 GGTCTTAAAA 0.968485 -26 GTTCTGGGAATAACTCCCTC 5 1 1 GTTCTGGGAA 0.94347 -136 ACATGGGATCGTCCTGAAAGATAAAGAAGG 5 39 0 GTCCTGAAAG 0.870667 -98 ATACATATCGGTTCTGTGAAGGAATGAGAA 5 68 0 GTTCTGTGAA 0.973759 -69 GGTCTTTAACCTCCATTAAC 5 127 0 GGTCTTTAAC 0.890855 -10 ********** Masking position 5 Map Score: 6.62848 Number of sites scoring better than the average of aligned sites = 348 Number in coding regions = 326 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 2 AGAGCTTTAATTGGCATAAAATTGAAAATCAGAA 2 179 0 TTGAAAAATG 0.969755 -122 AAATGCTTTTTACGCAGAAAAAAGAGCTTTAATT 2 201 0 TAGAAAAAAG 0.947815 -100 TTATCAACATTAGATAAAAAATTGGGCTGACACG 2 242 1 TAAAAAAATG 0.984138 -59 ACGAAAGTTTTTTATACAAAATGGATTGATTGTG 2 273 1 TTAAAAAATG 0.979445 -28 GTCGGGGTCTTAAAAATAAAGTAGTATGTTAACT 4 15 0 TAAAAAAGTG 0.986829 -35 CTTCAGAAAAAGTCGGGGTCTTAAA 4 35 0 TTAAAAAGTG 0.982918 -15 GGATCGTCCTGAAAGATAAAGAAGGACTACTCTG 5 30 0 GAAAAAAGAG 0.909332 -107 ** * * ***** * Masking position 8 Map Score: 5.70838 Number of sites scoring better than the average of aligned sites = 49 Number in coding regions = 36 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 3 TCCAAAAGAGTGGAAAATGTCCTTAAAAGC 2 72 1 TGGAAAATGT 0.964877 -229 ACTTTGGTTTTTGAAAATCTAAAAACTGTC 2 103 1 TTGAAAATCT 0.973732 -198 TATCAGACCTTGGATAATGATTTTAGTTTT 2 138 0 TGGATAATGA 0.964847 -163 TGGCATAAAATTGAAAATCAGAATTTCAAA 2 172 0 TTGAAAATCA 0.98152 -129 TTATCTAATGTTGATAAACATTCTAAATGC 2 229 0 TTGATAAACA 0.918459 -72 ********** Masking position 6 Map Score: 2.88118 Number of sites scoring better than the average of aligned sites = 116 Number in coding regions = 106 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 4 CCTTAAAAGCGACTTTGGTTTTTGAAAATC 2 92 1 GACTTTGGTT 0.948623 -209 TAAAAGGACAGTTTTTAGATTTTCAAAAAC 2 109 0 GTTTTTAGAT 0.934192 -192 CTTGGATAATGATTTTAGTTTTAAAAGGAC 2 130 0 GATTTTAGTT 0.934192 -171 AAATTTATCAGACCTTGGATAATGATTTTA 2 143 0 GACCTTGGAT 0.966599 -158 GTTCTGGGAATAACTCCCTC 5 1 1 GTTCTGGGAA 0.877731 -136 CGATATAGGTGTTCTGAGTTAATGGAGGTT 5 110 1 GTTCTGAGTT 0.948731 -27 ********** Masking position 5 Map Score: 1.30045 Number of sites scoring better than the average of aligned sites = 167 Number in coding regions = 147 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 5 ********** No masking Map Score: -7.43638e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -7.43638e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -7.43638e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0