AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i123_aful_mthe_100.orf -o123_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG50240 202 Archaeoglobus_fulgidus #2 RTH00401 96 M.thermo Motif number 1 TTAAATACGGGCTCGACGGGATTTGAACCC 1 27 1 GCTCGACGGG 0.997634 -176 TTGAACCCGCGACCGACGGGTTAAAAGCCC 1 49 1 GACCGACGGG 0.99873 -154 CAGCCAGGCAGAGCGACGGGCTTTTAACCC 1 66 0 GAGCGACGGG 0.99931 -137 CTGCCTGGCTGAGCTACGAGCCCTCATCCA 1 85 1 GAGCTACGAG 0.991946 -118 GTGCATTCGAGATTTGCGGGGAAAAGGC 1 185 1 GATTTGCGGG 0.972877 -18 ********** Masking position 7 Map Score: 10.3515 Number of sites scoring better than the average of aligned sites = 47 Number in coding regions = 44 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 CGTCGGTCGCGGGTTCAAATCCCGTCGAGCC 1 36 0 GGGTTAAATC 0.992227 -167 CGCGACCGACGGGTTAAAAGCCCGTCGCTCT 1 56 1 GGGTTAAAGC 0.992452 -147 GCGATGGTGAGGATTTAAATCTTTTTCGTGC 1 118 1 GGATTAAATC 0.988408 -85 CGAGATTTGCGGGGAAAAGGC 1 192 1 GGGGAAAGGC 0.980157 -11 ATACTATCAGGGATAAAAATCTAACCATAAT 2 45 1 GGATAAAATC 0.98984 -52 ***** ***** Masking position 7 Map Score: 7.59673 Number of sites scoring better than the average of aligned sites = 59 Number in coding regions = 38 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 CCTATTTTTAAATACGGGCTCGACGGGATTT 1 20 1 ATACGGGCTC 0.92396 -183 TAACCCGTCGGTCGCGGGTTCAAATCCCGTC 1 41 0 GCGCGGGTTC 0.994081 -162 GCCAGGCAGAGCGACGGGCTTTTAACCCGTC 1 63 0 GGACGGGCTT 0.985515 -140 ATCGCTAATGGATGAGGGCTCGTAGCTCAGC 1 92 0 GTGAGGGCTC 0.996491 -111 CATTAGCGATGGTGAGGATTTAAATCTTTTT 1 113 1 GTGAGGATTT 0.969071 -90 TAGTGATGCTGTGGAGGGTGCATGA 2 5 0 GGGAGGGTGC 0.991361 -92 CTTCAGGGTCGCGGAGGATTTGG 2 84 1 GGGAGGATTT 0.980105 -13 * ********* Masking position 6 Map Score: 8.9409 Number of sites scoring better than the average of aligned sites = 543 Number in coding regions = 507 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 4 TTGATCCTCCTATTTTTAAATACGGGCTCGA 1 12 1 TATTTTAAAT 0.871033 -191 TGAGGATTTAAATCTTTTTCGTGCTCTAAAG 1 125 1 AATTTTTTCG 0.847005 -78 CCTTTGCTTGTATCTTTAGAGCACGAAAAAG 1 138 0 TATTTTAGAG 0.981988 -65 AAAGGACAGATATATTTATCGGTGCATTCGA 1 164 1 TATTTTATCG 0.976673 -39 TGATAGTATAAATTGTTATAGTGATGCTGTG 2 23 0 AATGTTATAG 0.957339 -74 CATCGGGTATTATGGTTAGATTTTTATCCCT 2 53 0 TATGTTAGAT 0.938547 -44 *** ******* Masking position 6 Map Score: 1.27292 Number of sites scoring better than the average of aligned sites = 66 Number in coding regions = 48 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 5 TGAACCCGCGACCGACGGGTTAAAAGCCCG 1 50 1 ACCGACGGGT 0.945725 -153 GGGTTAAAAGCCCGTCGCTCTGCCTGGCTG 1 66 1 CCCGTCGCTC 0.970342 -137 CTCATCCATTAGCGATGGTGAGGATTTAAA 1 107 1 AGCGATGGTG 0.985605 -96 AAATTGTTATAGTGATGCTGTGGAGGGTGC 2 15 0 AGTGATGCTG 0.956973 -82 AACCATAATACCCGATGCTTCAGGGTCGCG 2 67 1 CCCGATGCTT 0.989715 -30 CCAAATCCTCCGCGACCCTGAAGCATCGGG 2 77 0 CGCGACCCTG 0.987682 -20 ********** Masking position 4 Map Score: 2.88327 Number of sites scoring better than the average of aligned sites = 546 Number in coding regions = 508 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 6 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0