AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i123_aful_mthe_300.orf -o123_aful_mthe_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG50240 202 Archaeoglobus_fulgidus #2 RTH00401 96 M.thermo Motif number 1 GGGTTCAAATCCCGTCGAGCCCGTATTTAA 1 27 0 CCCGTCGAGC 0.997848 -176 GGGCTTTTAACCCGTCGGTCGCGGGTTCAA 1 49 0 CCCGTCGGTC 0.998845 -154 GGGTTAAAAGCCCGTCGCTCTGCCTGGCTG 1 66 1 CCCGTCGCTC 0.999373 -137 TGGATGAGGGCTCGTAGCTCAGCCAGGCAG 1 85 0 CTCGTAGCTC 0.992673 -118 GCCTTTTCCCCGCAAATCTCGAATGCAC 1 185 0 CCCGCAAATC 0.975281 -18 ********** Masking position 4 Map Score: 10.3515 Number of sites scoring better than the average of aligned sites = 47 Number in coding regions = 44 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 GGCTCGACGGGATTTGAACCCGCGACCGACG 1 36 1 GATTTAACCC 0.992182 -167 AGAGCGACGGGCTTTTAACCCGTCGGTCGCG 1 56 0 GCTTTAACCC 0.992401 -147 GCACGAAAAAGATTTAAATCCTCACCATCGC 1 118 0 GATTTAATCC 0.988463 -85 GCCTTTTCCCCGCAAATCTCG 1 192 0 GCCTTTCCCC 0.980666 -11 ATTATGGTTAGATTTTTATCCCTGATAGTAT 2 45 0 GATTTTATCC 0.990089 -52 ***** ***** Masking position 5 Map Score: 7.59673 Number of sites scoring better than the average of aligned sites = 59 Number in coding regions = 38 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 AAATCCCGTCGAGCCCGTATTTAAAAATAGG 1 20 0 GAGCCCGTAT 0.929987 -183 GACGGGATTTGAACCCGCGACCGACGGGTTA 1 41 1 GAACCCGCGC 0.994589 -162 GACGGGTTAAAAGCCCGTCGCTCTGCCTGGC 1 63 1 AAGCCCGTCC 0.986615 -140 GCTGAGCTACGAGCCCTCATCCATTAGCGAT 1 92 1 GAGCCCTCAC 0.996788 -111 AAAAAGATTTAAATCCTCACCATCGCTAATG 1 113 0 AAATCCTCAC 0.97167 -90 TCATGCACCCTCCACAGCATCACTA 2 5 1 GCACCCTCCC 0.992102 -92 CCAAATCCTCCGCGACCCTGAAG 2 84 0 AAATCCTCCC 0.981794 -13 ********* * Masking position 6 Map Score: 8.9409 Number of sites scoring better than the average of aligned sites = 543 Number in coding regions = 507 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 4 TCGAGCCCGTATTTAAAAATAGGAGGATCAA 1 12 0 ATTTAAAATA 0.874627 -191 CTTTAGAGCACGAAAAAGATTTAAATCCTCA 1 125 0 CGAAAAAATT 0.851155 -78 CTTTTTCGTGCTCTAAAGATACAAGCAAAGG 1 138 1 CTCTAAAATA 0.982552 -65 TCGAATGCACCGATAAATATATCTGTCCTTT 1 164 0 CGATAAAATA 0.9774 -39 CACAGCATCACTATAACAATTTATACTATCA 2 23 1 CTATAACATT 0.958642 -74 AGGGATAAAAATCTAACCATAATACCCGATG 2 53 1 ATCTAACATA 0.940388 -44 ******* *** Masking position 6 Map Score: 1.27292 Number of sites scoring better than the average of aligned sites = 66 Number in coding regions = 48 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 5 CGGGCTTTTAACCCGTCGGTCGCGGGTTCA 1 50 0 ACCCGTCGGT 0.943044 -153 CAGCCAGGCAGAGCGACGGGCTTTTAACCC 1 66 0 GAGCGACGGG 0.968523 -137 TTTAAATCCTCACCATCGCTAATGGATGAG 1 107 0 CACCATCGCT 0.984861 -96 GCACCCTCCACAGCATCACTATAACAATTT 2 15 1 CAGCATCACT 0.954374 -82 CGCGACCCTGAAGCATCGGGTATTATGGTT 2 67 0 AAGCATCGGG 0.989122 -30 CCCGATGCTTCAGGGTCGCGGAGGATTTGG 2 77 1 CAGGGTCGCG 0.986937 -20 ********** Masking position 7 Map Score: 2.88327 Number of sites scoring better than the average of aligned sites = 546 Number in coding regions = 508 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 6 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0