AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i138_aful_mthe_100.orf -o138_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG34641 45 Archaeoglobus_fulgidus #2 RTH01072 116 M.thermo #3 RTH02077 102 M.thermo Motif number 1 GCAGCGTCCGTTAAATATATATTGCGAGTC 1 21 1 TTAAATATAT 0.915467 -25 TAAAATATATAAACATTTATTAAGATAGGA 2 17 0 AAACATTTAT 0.936278 -100 AATTTTAACATAAAATATATAAACATTTAT 2 27 0 TAAAATATAT 0.982539 -90 TATTTTATGTTAAAATTTATTAAATTTTAT 2 40 1 TAAAATTTAT 0.975326 -77 TAAAATTTATTAAATTTTATCGTTTATATT 2 50 1 TAAATTTTAT 0.961359 -67 TCGTTTATATTAACAATTATTATATGGTTG 2 69 1 TAACAATTAT 0.958121 -48 ********** Masking position 3 Map Score: 8.3591 Number of sites scoring better than the average of aligned sites = 20 Number in coding regions = 7 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 2 GCTCCGTGTTGCAGCGTCCGTTAAA 1 6 1 GTGTTGCAGC 0.988066 -40 TCGGATACCGGGAATTCAGCATTTCAA 3 8 0 GGAATTCAGC 0.992849 -95 TTCAGTATCTGTGATTCAGCTGATGCTGTC 3 53 0 GTGATTCAGC 0.997204 -50 TCACGTCATAAGGATTCAGTATCTGTGATT 3 67 0 AGGATTCAGT 0.972181 -36 ********** Masking position 5 Map Score: 3.82324 Number of sites scoring better than the average of aligned sites = 194 Number in coding regions = 187 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 3 CTCCGTGTTGCAGCGTCCGTTAAATATATA 1 12 1 CAGCGTCCGT 0.995026 -34 GCTGAATTCCCGGTATCCGAGTACAATGAG 3 18 1 CGGTATCCGA 0.986521 -85 GAGAAGATGACAGCATCAGCTGAATCACAG 3 45 1 CAGCATCAGC 0.990577 -58 CATAAGGATTCAGTATCTGTGATTCAGCTG 3 61 0 CAGTATCTGT 0.987784 -42 ********** Masking position 6 Map Score: 2.64355 Number of sites scoring better than the average of aligned sites = 87 Number in coding regions = 82 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 4 TAAACATTTATTAAGATAGGATCTTCC 2 8 0 TTAAGATAGG 0.963974 -109 AAATGTTTATATATTTTATGTTAAAATTTA 2 29 1 ATATTTTATG 0.889046 -88 ATATTAACAATTATTATATGGTTGCGTTGA 2 75 1 TTATTATATG 0.97421 -42 AACCACCCTGTTAAGTTATGTCAACGCAAC 2 95 0 TTAAGTTATG 0.976445 -22 TACTGAATCCTTATGACGTGAACGATCCAA 3 76 1 TTATGACGTG 0.945272 -27 ********** Masking position 3 Map Score: 1.49646 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 26 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 5 TAATAAATGTTTATATATTTTATGTTAAAA 2 25 1 TTATATATTT 0.903936 -92 ATTTATTAAATTTTATCGTTTATATTAACA 2 54 1 TTTTATCGTT 0.983041 -63 TTAACAATTATTATATGGTTGCGTTGACAT 2 78 1 TTATATGGTT 0.982315 -39 TCCTTCCTTGGATCGTTCACGTCATAA 3 86 0 TTGGATCGTT 0.980535 -17 ********** Masking position 5 Map Score: 0.885916 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 24 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 6 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0