AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i156_aful_mthe_300.orf -o156_aful_mthe_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RAG48486 59 Archaeoglobus_fulgidus Input sequences: #1 RAG35803 59 Archaeoglobus_fulgidus #2 RTH00077 20 M.thermo #3 RTH01952 83 M.thermo #4 RTH01119 67 M.thermo #5 RTH01092 177 M.thermo #6 RTH00291 110 M.thermo Motif number 1 AGTTTTCGCAATATTTTTAAAAGCTTTTCT 1 25 0 ATATTTTTAA 0.783506 -35 TAATAGAGTTATCTATATAAAAATTGTTAA 3 31 0 ATCTATATAA 0.951912 -53 GGCCTCCTCCATATATATATGATCGTGATA 4 19 1 ATATATATAT 0.497908 -49 ACACTTAAAGATCTATTTATCACGATCATA 4 36 0 ATCTATTTAT 0.861604 -32 TTATAAGTACATCAATATAATCTTAGCATA 5 19 1 ATCAATATAA 0.884324 -159 TTTCCCACAAATCTTTATATGTGACGGATC 6 32 1 ATCTTTATAT 0.951912 -79 TATGTGACGGATCTTTATCTAAACATTAGT 6 49 1 ATCTTTATCT 0.925055 -62 ********** Masking position 1 Map Score: 6.84672 Number of sites scoring better than the average of aligned sites = 21 Number in coding regions = 13 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 2 TCATCATGAGCTTAAGAAAAGCT 1 4 1 TCATGAGCTT 0.848865 -56 CTCTTTAGTCTGACAAAATTT 3 73 0 TCTTTAGTCT 0.891322 -11 AATCCTTTGGCCTCCTCCATATA 4 4 1 CCTTTGGCCT 0.988603 -64 TTTCTATCTACCTTGAGTTTGCATGAGTTC 5 52 0 CCTTGAGTTT 0.934174 -126 ATAGTCCAGGGCGTTGGCTTCAGGCCAGCG 5 111 1 GCGTTGGCTT 0.949383 -67 AGTCTGTAGACCGCTGGCCTGAAGCCAACG 5 122 0 CCGCTGGCCT 0.976722 -56 CTCACGTATCCCGTGAGGCTGAGTTCCTTT 5 155 0 CCGTGAGGCT 0.974835 -23 ********** Masking position 10 Map Score: 2.10813 Number of sites scoring better than the average of aligned sites = 630 Number in coding regions = 601 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 3 TATATAAAAATTGTTAATTACCGGAAGGTGA 3 17 0 TTGTTAATAC 0.957263 -67 TAATTAACAATTTTTATATAGATAACTCTAT 3 28 1 TTTTTATTAG 0.93561 -56 CTGACAAAATTTTATAATTAGAATTAATAGA 3 54 0 TTTATAATAG 0.974881 -30 ATATATGATCGTGATAAATAGATCTTTAAGT 4 33 1 GTGATAATAG 0.921475 -35 TACCTAATTTATAAGTACATCAATATAA 5 8 1 TTTATAATAC 0.97482 -170 GCACGGTACATTTCTATCTACCTTGAGTTTG 5 61 0 TTTCTATTAC 0.924317 -117 ******* *** Masking position 6 Map Score: 1.49059 Number of sites scoring better than the average of aligned sites = 36 Number in coding regions = 17 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 4 ATAGATAACTCTATTAATTCTAATTATAAA 3 45 1 CTATTAATTC 0.95046 -39 GGTATTAATTCAATGGCATTG 6 2 1 GTATTAATTC 0.735866 -109 GACTTTAATCCTATTAATTTGGAGAGGGTT 6 86 1 CTATTAATTT 0.968366 -25 ********** Masking position 6 Map Score: 1.30906 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 TTGCATGAGTTCTCCTATGCTAAGATTATA 5 34 0 TCTCCTATGC 0.94487 -144 TACATTTCTATCTACCTTGAGTTTGCATGA 5 56 0 TCTACCTTGA 0.970416 -122 TAGATAGAAATGTACCGTGCCCATCTCACA 5 72 1 TGTACCGTGC 0.981489 -106 GACTATTCCCTCCACTGTGAGATGGGCACG 5 87 0 TCCACTGTGA 0.96309 -91 GTTCTCACGTATCCCGTGAGGCTGAGTTC 5 159 0 TATCCCGTGA 0.972762 -19 ********** Masking position 8 Map Score: 0.131903 Number of sites scoring better than the average of aligned sites = 171 Number in coding regions = 163 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 6 ********** No masking Map Score: -5.94424e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -5.94424e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -5.94424e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0