AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i173_aful_mthe_100.orf -o173_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01486 123 M.thermo #2 RTH00930 246 M.thermo Motif number 1 TATTATTCATTTAATAAGGCATTCATATCG 2 102 0 TTAATAAGGC 0.983144 -145 TAATAACACCTTTATAAGGGTTTAAATAAT 2 140 0 TTTATAAGGG 0.995544 -107 CAGCCGATGATTTTTAAGGGGGGCGCGGCA 2 172 1 TTTTTAAGGG 0.985486 -75 CGCGGCACCTTTAATATGGGTGGTGAACAT 2 195 1 TTAATATGGG 0.979356 -52 GACATTAGATTCTATAAGGAG 2 236 1 TCTATAAGGA 0.954537 -11 ********** Masking position 5 Map Score: 5.94367 Number of sites scoring better than the average of aligned sites = 35 Number in coding regions = 29 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 ACAGGGAACAGGCCGATGGAATGATCCCAG 1 44 0 GGCCGATGGA 0.98529 -80 GTTTCCTTGTGGATGATGAGGGCTCTGACT 1 94 1 GGATGATGAG 0.986635 -30 AAAACAGAGAGGATGATGCAGAGCCCCTTA 2 47 1 GGATGATGCA 0.989703 -200 AAAAATCATCGGCTGATTAATAACACCTTT 2 157 0 GGCTGATTAA 0.979828 -90 CCTTTAATATGGGTGGTGAACATAAAATTA 2 202 1 GGGTGGTGAA 0.984139 -45 ********** Masking position 7 Map Score: 3.89282 Number of sites scoring better than the average of aligned sites = 223 Number in coding regions = 206 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 3 TGTGGATGATGAGGGCTCTGACTACACCGA 1 101 1 GAGGGCTCTG 0.98195 -23 AGGGAAATTAAGGGGCTCTGCATCATCCTC 2 55 0 AGGGGCTCTG 0.995293 -192 GATTTTTAAGGGGGGCGCGGCACCTTTAAT 2 180 1 GGGGGCGCGG 0.998156 -67 ********** Masking position 5 Map Score: 3.11222 Number of sites scoring better than the average of aligned sites = 14 Number in coding regions = 13 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ACAGGCCGATGGAATGATCCCAGCTGTCCAGCT 1 34 0 GGAAGATCCG 0.98576 -90 TCATTCCATCGGCCTGTTCCCTGTCAGCAAGTA 1 50 1 GGCCGTTCCG 0.995693 -74 GTACCAGTTTGAACGTTTCCTTGTGGATGATGA 1 80 1 GAACTTTCCG 0.989139 -44 CCCTCTATACGAACAGTTCCACGATATGAATGC 2 81 1 GAACGTTCCG 0.997901 -166 CCACCCATATTAAAGGTGCCGCGCCCCCCTTAA 2 185 0 TAAAGTGCCG 0.947948 -62 **** ***** * Masking position 9 Map Score: 1.80477 Number of sites scoring better than the average of aligned sites = 46 Number in coding regions = 43 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0