AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i177_aful_mthe_100.orf -o177_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG26588 73 Archaeoglobus_fulgidus #2 RTH01626 132 M.thermo Motif number 1 GGCCGACAGAAGATGATGGAGTTTAGAGAC 2 15 0 AGATGATGGA 0.997066 -118 TATCTTACGGGGCTGATGCATTCCATCAGC 2 51 1 GGCTGATGCA 0.996673 -82 AAATGACCGGAGCTGATGGAATGCATCAGC 2 62 0 AGCTGATGGA 0.998091 -71 GTATGATGGTCAGCGCTCAA 2 123 0 GTATGATGGT 0.981265 -10 ********** Masking position 6 Map Score: 6.1582 Number of sites scoring better than the average of aligned sites = 153 Number in coding regions = 149 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 2 AAAGCTAAATTACCGAAGTGAAACTTCTGC 1 52 1 TACCGAAGTG 0.977395 -22 TGGCAGAAGTTTCACTTCGGT 1 63 0 GGCAGAAGTT 0.990087 -11 CCCTGCGGCCGACAGAAGATGATGGAGTTT 2 21 0 GACAGAAGAT 0.981394 -112 ATCTTCTGTCGGCCGCAGGGTATCTTACGG 2 31 1 GGCCGCAGGG 0.991624 -102 AGAGAAAAATGACCGGAGCTGATGGAATGC 2 68 0 GACCGGAGCT 0.990346 -65 ********** Masking position 7 Map Score: 4.15376 Number of sites scoring better than the average of aligned sites = 272 Number in coding regions = 263 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 3 GCTAAGGTTTAACCTCAAAAC 1 2 1 CTAAGGTTTA 0.964857 -72 AAACCTTAAATTAAGTTTTGAGGTTAAACC 1 16 0 TTAAGTTTTG 0.971958 -58 AAAACTTAATTTAAGGTTTTCTGTAAAAGC 1 27 1 TTAAGGTTTT 0.992098 -47 ACTTCGGTAATTTAGCTTTTACAGAAAACC 1 41 0 TTTAGCTTTT 0.967033 -33 ********** Masking position 4 Map Score: 2.30878 Number of sites scoring better than the average of aligned sites = 95 Number in coding regions = 56 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 54 Fraction of orfs with sites within 600 bp upstream = 0.00867331 Motif number 4 TGTAAAAGCTAAATTACCGAAGTGAAACTT 1 48 1 AAATTACCGA 0.984896 -26 AAACAGAGAAAAATGACCGGAGCTGATGGA 2 72 0 AAATGACCGG 0.996221 -61 AATTTAAATAAATTGAGCGCTGACCATCAT 2 111 1 AATTGAGCGC 0.98784 -22 ********** Masking position 6 Map Score: 0.306544 Number of sites scoring better than the average of aligned sites = 20 Number in coding regions = 18 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 ********** No masking Map Score: 3.50598e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.50598e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.50598e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0