AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i179_aful_mthe_100.orf -o179_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG46815 38 Archaeoglobus_fulgidus #2 RAG26652 64 Archaeoglobus_fulgidus #3 RTH01987 83 M.thermo Motif number 1 AAACTTGAAATATAACTTTTTGC 1 3 0 TAAACTTTTT 0.975777 -36 AGATAACTCTTAAAACCTTTGCCTTCTTACG 2 17 0 TAAACCTTTG 0.992913 -48 ACCTCAGGCGTAGAACTTCTGAGATAACTCT 2 38 0 TAAACTTCTG 0.981382 -27 GATATCACCTCAGGCGTAGAACT 2 52 0 TACACCTCAG 0.962284 -13 GTTTGAATACTCTAACCTTGTAGGAGAAATA 3 43 0 TCAACCTTGT 0.971961 -41 GTTAGAGTATTCAAACATCTTTATAAAGATT 3 58 1 TCAACATCTT 0.968094 -26 ** ******** Masking position 5 Map Score: 5.4034 Number of sites scoring better than the average of aligned sites = 265 Number in coding regions = 229 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 2 GTGTCCACCTCACAGAAACTTGA 1 26 0 TCCACCTCAC 0.989961 -13 TTTGCCTTCTTACGCCACAC 2 1 0 TACGCCACAC 0.992167 -64 TCAGAAGTTCTACGCCTGAGGTGATATC 2 47 1 TACGCCTGAG 0.981679 -18 CGGTATTCACCATATGAGAACTTGC 3 6 1 TTCACCATAT 0.971608 -78 GAGAACTTGCTTCCCCTTATTTCTCCTACA 3 26 1 TTCCCCTTAT 0.976312 -58 ********** Masking position 9 Map Score: 2.81152 Number of sites scoring better than the average of aligned sites = 314 Number in coding regions = 292 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 3 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0