AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i179_aful_mthe_300.orf -o179_aful_mthe_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG46815 38 Archaeoglobus_fulgidus #2 RAG26652 64 Archaeoglobus_fulgidus #3 RTH01987 83 M.thermo Motif number 1 GCAAAAAGTTATATTTCAAGTTT 1 3 1 AAAAAGTTTA 0.976221 -36 CGTAAGAAGGCAAAGGTTTTAAGAGTTATCT 2 17 1 CAAAGGTTTA 0.99304 -48 AGAGTTATCTCAGAAGTTCTACGCCTGAGGT 2 38 1 CAGAAGTTTA 0.981394 -27 AGTTCTACGCCTGAGGTGATATC 2 52 1 CTGAGGTGTA 0.962998 -13 TATTTCTCCTACAAGGTTAGAGTATTCAAAC 3 43 1 ACAAGGTTGA 0.972496 -41 AATCTTTATAAAGATGTTTGAATACTCTAAC 3 58 0 AAGATGTTGA 0.968696 -26 ******** ** Masking position 7 Map Score: 5.4034 Number of sites scoring better than the average of aligned sites = 265 Number in coding regions = 229 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 2 TCAAGTTTCTGTGAGGTGGACAC 1 26 1 GTGAGGTGGA 0.989215 -13 GTGTGGCGTAAGAAGGCAAA 2 1 1 GTGTGGCGTA 0.991583 -64 GATATCACCTCAGGCGTAGAACTTCTGA 2 47 0 CTCAGGCGTA 0.98033 -18 GCAAGTTCTCATATGGTGAATACCG 3 6 0 ATATGGTGAA 0.96954 -78 TGTAGGAGAAATAAGGGGAAGCAAGTTCTC 3 26 0 ATAAGGGGAA 0.974578 -58 ********** Masking position 2 Map Score: 2.81152 Number of sites scoring better than the average of aligned sites = 314 Number in coding regions = 292 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 3 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0