AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i194_aful_mthe_100.orf -o194_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG17482 60 Archaeoglobus_fulgidus #2 RAG17481 39 Archaeoglobus_fulgidus Motif number 1 CCCCACCAAAAGGAAATGGTAGGGCAGGCA 1 27 1 AGGAAATGGT 0.99795 -34 ATGGTAGGGCAGGCATCGGTGAGAGGAGC 1 42 1 AGGCATCGGT 0.997536 -19 GAGGAAAAGGTTAAGAGGCAA 2 29 0 AGGAAAAGGT 0.998301 -11 ********** Masking position 5 Map Score: 5.88794 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 26 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 2 ATTTTTTACACAGCCCCACCAAAAGGAAAT 1 14 1 CAGCCCCACC 0.999603 -47 TCACCGATGCCTGCCCTACCATTTCCTTTT 1 34 0 CTGCCCTACC 0.999412 -27 ********** Masking position 8 Map Score: 2.96342 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 28 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 3 GGGCAGGCATCGGTGAGAGGAGC 1 48 1 CGGTGAGAGG 0.998679 -13 GAGGAAAAGGTTAAGAGGCAAAATAAAG 2 22 0 GGTTAAGAGG 0.997324 -18 ********** Masking position 6 Map Score: 0.341791 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 15 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 AAAATTTTTTACACAGCCCCA 1 2 1 AAATTTTTTA 0.978691 -59 CTCAGAAAACTCTTTATTTTGCCTCT 2 7 1 AAACTCTTTA 0.989764 -33 TTTTGCCTCTTAACCTTTTCCTC 2 27 1 TAACCTTTTC 0.979227 -13 ********** Masking position 3 Map Score: 0.387054 Number of sites scoring better than the average of aligned sites = 125 Number in coding regions = 81 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 57 Fraction of orfs with sites within 600 bp upstream = 0.00915516 Motif number 5 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0