AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i194_aful_mthe_300.orf -o194_aful_mthe_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG17482 60 Archaeoglobus_fulgidus #2 RAG17481 39 Archaeoglobus_fulgidus Motif number 1 CCCCACCAAAAGGAAATGGTAGGGCAGGCA 1 27 1 AGGAAATGGT 0.998085 -34 ATGGTAGGGCAGGCATCGGTGAGAGGAGC 1 42 1 AGGCATCGGT 0.997782 -19 GAGGAAAAGGTTAAGAGGCAA 2 29 0 AGGAAAAGGT 0.99848 -11 ********** Masking position 5 Map Score: 5.88794 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 26 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 2 ATTTTTTACACAGCCCCACCAAAAGGAAAT 1 14 1 CAGCCCCACC 0.999605 -47 TCACCGATGCCTGCCCTACCATTTCCTTTT 1 34 0 CTGCCCTACC 0.999414 -27 ********** Masking position 8 Map Score: 2.96342 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 28 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 3 GGCAGGCATCGGTGAGAGGAGC 1 49 1 GGTGAGAGGA 0.998074 -12 GAGGAAAAGGTTAAGAGGCAAAATAAAGA 2 21 0 GTTAAGAGGC 0.997122 -19 ********** Masking position 5 Map Score: 0.341791 Number of sites scoring better than the average of aligned sites = 37 Number in coding regions = 36 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 AAAATTTTTTACACAGCCCC 1 1 1 AAAATTTTTT 0.613066 -60 CTCAGAAAACTCTTTATTTTGCCTC 2 6 1 AAAACTCTTT 0.880489 -34 ATTTTGCCTCTTAACCTTTTCCTC 2 26 1 TTAACCTTTT 0.959961 -14 ********** Masking position 4 Map Score: 0.387054 Number of sites scoring better than the average of aligned sites = 153 Number in coding regions = 93 Number in noncoding regions = 60 Number of orfs with sites within 600 bp upstream = 82 Fraction of orfs with sites within 600 bp upstream = 0.0131706 Motif number 5 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0