AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i231_aful_mthe_300.orf -o231_aful_mthe_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG23889 59 Archaeoglobus_fulgidus #2 RAG47920 34 Archaeoglobus_fulgidus #3 RTH00791 150 M.thermo #4 RTH01825 139 M.thermo Motif number 1 TGGGAAAGATTTTAAAATGAGTTGT 1 6 1 AAGATTTTAA 0.987968 -54 GTTATTTTAACACGTTTGTC 2 1 1 GTTATTTTAA 0.955975 -34 CTTACAAATTTTTATTTTAATATATGGGGG 3 48 0 TTTATTTTAA 0.888377 -103 TTGTAAGTAAAATATTTTAAGTAGGAGAAA 3 71 1 AATATTTTAA 0.981049 -80 ATTGATAACTGTGATTTTAATTTTAACCAC 3 103 1 GTGATTTTAA 0.971784 -48 CAATGTATTTAAGATTTTAGTGTTCAATAT 4 75 0 AAGATTTTAG 0.956159 -65 CATCTTGAGTAATATTTTCACCAGCAATGT 4 99 0 AATATTTTCA 0.967013 -41 AATATTACTCAAGATGTTCATTGTGGGAGA 4 113 1 AAGATGTTCA 0.925094 -27 ********** Masking position 4 Map Score: 11.3793 Number of sites scoring better than the average of aligned sites = 144 Number in coding regions = 118 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 2 TCGCTGACCTGTGCAGAAAAAGTATATAAC 1 34 0 GTGCAGAAAA 0.973024 -26 CTCTCACAAATTGGACAAACGTGTTAAAAT 2 14 0 TTGGACAAAC 0.968924 -21 ATGCAACATGGTGGAGATACCTTTATAAGG 3 14 1 GTGGAGATAC 0.98387 -137 ATATTTTAAGTAGGAGAAACAATTGATAAC 3 82 1 TAGGAGAAAC 0.9644 -69 ATTAAGTGAAGTGGTTAAAATTAAAATCAC 3 113 0 GTGGTTAAAA 0.941709 -38 AAATACATTGCTGGTGAAAATATTACTCAA 4 95 1 CTGGTGAAAA 0.969192 -45 ********** Masking position 7 Map Score: 3.10132 Number of sites scoring better than the average of aligned sites = 588 Number in coding regions = 546 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 3 CCTCTCACAAATTGGACAAAC 2 24 0 CTCTCACAAA 0.977623 -11 ATGGGGGTTCCCCTTATAAAGGTATCTCCA 3 25 0 CCCTTATAAA 0.936559 -126 ATAAGGGGAACCCCCATATATTAAAATAAA 3 38 1 CCCCCATATA 0.985775 -113 TCAATTGTTTCTCCTACTTAAAATATTTTA 3 78 0 CTCCTACTTA 0.926199 -73 TATTCAAATGCCTCCATTAAGTGAAGTGGT 3 128 0 CCTCCATTAA 0.914679 -23 TTAACCATCTCCCACAATGAACATCTTG 4 122 0 CTCCCACAAT 0.969603 -18 ********** Masking position 6 Map Score: 2.61067 Number of sites scoring better than the average of aligned sites = 539 Number in coding regions = 496 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 4 TATAACAACTCATTTTAAAATCTTTCCCA 1 10 0 CATTTTAAAA 0.978881 -50 ATTGGACAAACGTGTTAAAATAAC 2 5 0 CGTGTTAAAA 0.933672 -30 TACAAATTTTTATTTTAATATATGGGGGTT 3 46 0 TATTTTAATA 0.783349 -105 GTAGGAGAAACAATTGATAACTGTGATTTT 3 91 1 CAATTGATAA 0.917063 -60 TTAATGGAGGCATTTGAATAGAA 3 138 1 CATTTGAATA 0.953139 -13 GGATCAGCCTCAAGTTATAATAGAAAACCG 4 18 0 CAAGTTATAA 0.917073 -122 ********** Masking position 5 Map Score: 1.71446 Number of sites scoring better than the average of aligned sites = 113 Number in coding regions = 70 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 53 Fraction of orfs with sites within 600 bp upstream = 0.00851269 Motif number 5 GCACAGGTCAGCGAGGTGAT 1 50 1 GCGAGGTGAT 0.989311 -10 ACCATGCAACATGGTGGAGATACCT 3 6 1 GCAACATGGT 0.97004 -145 CCTCCATTAAGTGAAGTGGTTAAAATTAAA 3 118 0 GTGAAGTGGT 0.980234 -33 TGTTCATTGTGGGAGATGGTTAA 4 127 1 GGGAGATGGT 0.992357 -13 ********** Masking position 4 Map Score: 0.554122 Number of sites scoring better than the average of aligned sites = 231 Number in coding regions = 216 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 6 ********** No masking Map Score: -7.29427e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -7.29427e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -7.29427e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0