AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i254_aful_mthe_100.orf -o254_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01260 198 M.thermo Motif number 1 TTTTTTAATCTGATAACTTATAACTTATCA 1 16 1 TGATAACTTA 0.997187 -183 AAAGTATATGTGATAAGTTATAAGTTATCA 1 26 0 TGATAAGTTA 0.992623 -173 AAGTTATAATTTATAACTTATAAAGTATAT 1 47 0 TTATAACTTA 0.99378 -152 AAGTTATAAATTATAACTTAGATCCAGCAG 1 58 1 TTATAACTTA 0.99378 -141 AAAGTGCTGCTGATAGATTAACGGCTGTTG 1 148 0 TGATAGATTA 0.975075 -51 ********** Masking position 5 Map Score: 11.7544 Number of sites scoring better than the average of aligned sites = 3 Number in coding regions = 3 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 ATAAACCAGAAGGGTGGCTGTGGAAAGACA 1 117 1 AGGGTGGCTG 0.996659 -82 TGATAGATTAACGGCTGTTGTTGTCTTTCC 1 138 0 ACGGCTGTTG 0.994783 -61 CAAGGAGGAAAGTGCTGCTGATAGATTAAC 1 156 0 AGTGCTGCTG 0.995 -43 CCTTGACAGGAGGGTTCTTGTAATCGAC 1 181 1 AGGGTTCTTG 0.991952 -18 ********** Masking position 9 Map Score: 4.57518 Number of sites scoring better than the average of aligned sites = 296 Number in coding regions = 279 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 3 AGCAGGTGATGAGATGGGAGAGGTAATTTC 1 83 1 GAGATGGGAG 0.982599 -116 AATCATAAACCAGAAGGGTGGCTGTGGAAA 1 113 1 CAGAAGGGTG 0.997201 -86 TCCTGTCAAGGAGGAAAGTGCTGCTGATAG 1 162 0 GAGGAAAGTG 0.972465 -37 TCCTCCTTGACAGGAGGGTTCTTGTAATCG 1 177 1 CAGGAGGGTT 0.992923 -22 ********** Masking position 2 Map Score: 2.60052 Number of sites scoring better than the average of aligned sites = 702 Number in coding regions = 670 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 4 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0