AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i257_aful_mthe_100.orf -o257_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01549 140 M.thermo Motif number 1 CACGCCACCATCTCCAGTCAATTATTTATT 1 14 1 TCTCCAGTCA 0.994416 -127 CAATTATTTATTTCCAGGAAGAGGAATCCA 1 32 1 TTTCCAGGAA 0.971877 -109 ATCTGCAACTCTTCCAGTAAGTCTGCAGAA 1 61 1 CTTCCAGTAA 0.986681 -80 TTCCAGTAAGTCTGCAGAAACCAGAAACCC 1 72 1 TCTGCAGAAA 0.98573 -69 CACAGGATCTTCTACACAAATTATTTATAG 1 101 1 TCTACACAAA 0.966664 -40 ********** Masking position 6 Map Score: 5.888 Number of sites scoring better than the average of aligned sites = 350 Number in coding regions = 313 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 2 TAATTGACTGGAGATGGTGGCGTGTGG 1 8 0 GAGATGGTGG 0.982279 -133 CTTACTGGAAGAGTTGCAGATGGATTCCTC 1 52 0 GAGTTGCAGA 0.984934 -89 GGTTTCTGCAGACTTACTGGAAGAGTTGCA 1 64 0 GACTTACTGG 0.980733 -77 AAGATCCTGTGGGTTTCTGGTTTCTGCAGA 1 82 0 GGGTTTCTGG 0.997077 -59 TTATCCATGGGTTTAAGGTTCTATAAAT 1 123 0 GGGTTTAAGG 0.983587 -18 ********** Masking position 5 Map Score: 5.31214 Number of sites scoring better than the average of aligned sites = 758 Number in coding regions = 722 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 3 CTTCCTGGAAATAAATAATTGACTGGAGAT 1 23 0 ATAAATAATT 0.992034 -118 TTAAGGTTCTATAAATAATTTGTGTAGAAG 1 109 0 ATAAATAATT 0.992034 -32 ********** Masking position 5 Map Score: 2.04472 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0