AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i269_aful_mthe_100.orf -o269_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00591 27 M.thermo #2 RTH00127 109 M.thermo Motif number 1 GTTCTATTAATCAAGATGGTGTTTTAA 1 7 1 TTATAAGATG 0.996309 -21 GTGGGATGTGATGATGAAGCTGT 2 2 0 ATATAAGCTG 0.97366 -108 AATGGAAAGATTTATAAATATGAAAATTTGTG 2 31 0 TTATAATATG 0.992505 -79 GGAATTATGATTAATATATATGTTATCCTTAC 2 68 0 TTATTATATG 0.986776 -42 TTAATTATTTTAATATGGTTGGAATTA 2 93 0 TATTAATATG 0.941231 -17 ** ** ****** Masking position 5 Map Score: 5.58431 Number of sites scoring better than the average of aligned sites = 55 Number in coding regions = 49 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 2 ACAGCTTCATCATCACATCCCACAAATTTT 2 10 1 TCTCACATCC 0.99284 -100 TATTTATAAATCTTTCCATTCAATTGTAAGG 2 43 1 TCTTCCATTC 0.995777 -67 ATATATGTTATCCTTACAATTGAATGGAAAG 2 54 0 TCTTACAATT 0.974669 -56 ATATTAATCATAATTCCAACCATATTAAAAT 2 83 1 TATTCCAACC 0.989233 -27 ** ******** Masking position 4 Map Score: 1.77172 Number of sites scoring better than the average of aligned sites = 320 Number in coding regions = 303 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 3 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0