AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i269_aful_mthe_300.orf -o269_aful_mthe_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00591 27 M.thermo #2 RTH00127 109 M.thermo #3 RTH01417 300 M.thermo Motif number 1 GTTCTATTAATCAAGATGGTGTTTTAA 1 11 1 TCAAGATGTG 0.984629 -17 GAATTAAGAATCAAGATAGAGCTGAAATCAG 3 41 1 TCAAGATGAG 0.991703 -260 ATTAGGCCATTCAAGATTCAGTACAACTACA 3 74 1 TCAAGATCAG 0.995646 -227 CAGCTGACTTGCAAGTTCCAGGTCAGCTATC 3 136 0 GCAAGTTCAG 0.982941 -165 CAAGTCAGCTGCATGGTGCAGATGGATTCAA 3 156 1 GCATGGTCAG 0.954688 -145 ACGGAACTGATCAAGAGCCTG 3 290 1 TCAAGAGCTG 0.978173 -11 ******* *** Masking position 3 Map Score: 7.29498 Number of sites scoring better than the average of aligned sites = 109 Number in coding regions = 102 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 ATCAAGATAGAGCTGAAATCAGACATTAGG 3 50 1 AGCTGAAATC 0.944601 -251 ACATGGTTGTAGTTGTACTGAATCTTGAAT 3 82 0 AGTTGTACTG 0.88948 -219 ACCGCAGGATAGCTGACCTGGAACTTGCAA 3 129 1 AGCTGACCTG 0.996302 -172 TGCACCATGCAGCTGACTTGCAAGTTCCAG 3 146 0 AGCTGACTTG 0.981 -155 CTGCGGGGTATGCTGATCTGTGAGAAGGTG 3 193 0 TGCTGATCTG 0.989229 -108 AAGTGGAATCTGCCGTCCTCTGAGAGAAGA 3 241 0 TGCCGTCCTC 0.921185 -60 CCGTGTTTGGTGATGATATGAAGAAGTGGA 3 264 0 TGATGATATG 0.827611 -37 ********** Masking position 9 Map Score: 4.50653 Number of sites scoring better than the average of aligned sites = 573 Number in coding regions = 538 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 3 TATGAAAATTTGTGGGATGTGATGATGAAGCTGT 2 9 0 TGGGATTGAT 0.988433 -101 TATTTTAATATGGTTGGAATTATGATTAATATATAT 2 79 0 TGTGGTTGAT 0.990641 -31 ATTGACATTATGTAGGGGGTATTGAATTAAGAATCA 3 18 1 TGGGGTTGAA 0.996626 -283 TGGTTGTAGTTGTACTGAATCTTGAATGGCCTAATG 3 73 0 TGCTGTTGAA 0.965978 -228 AAGGCCTTCCTGCGGGGTATGCTGATCTGTGAGAAG 3 196 0 TGGGGTTGAT 0.998191 -105 TCTTGATCAGTTCCGTGTTTGGTGATGATATGAAGA 3 270 0 TTGTGTTGAT 0.966518 -31 ** *** * **** Masking position 10 Map Score: 5.3094 Number of sites scoring better than the average of aligned sites = 165 Number in coding regions = 153 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 4 TGTGGGATGTGATGATGAAGCTGT 2 5 0 GATGATGAAG 0.942153 -105 GAATCAAGATAGAGCTGAAATCAGACATTA 3 48 1 AGAGCTGAAA 0.954973 -253 TCAGCTGCATGGTGCAGATGGATTCAAGTT 3 160 1 GGTGCAGATG 0.937295 -141 TGATCTGTGAGAAGGTGAAAAACTTGAATC 3 180 0 GAAGGTGAAA 0.920157 -121 CCGTCCTCTGAGAGAAGAAAGTTCTTGAAG 3 229 0 AGAGAAGAAA 0.91327 -72 TTCCGTGTTTGGTGATGATATGAAGAAGTG 3 266 0 GGTGATGATA 0.968904 -35 ********** Masking position 8 Map Score: 0.818936 Number of sites scoring better than the average of aligned sites = 1779 Number in coding regions = 1665 Number in noncoding regions = 114 Number of orfs with sites within 600 bp upstream = 97 Fraction of orfs with sites within 600 bp upstream = 0.0155798 Motif number 5 GTTCTATTAATCAAGATGGTGT 1 3 1 TCTATTAATC 0.984703 -25 AATTTTCATATTTATAAATCTTTCCATTCA 2 35 1 TTTATAAATC 0.960902 -75 GGATAACATATATATTAATCATAATTCCAA 2 72 1 TATATTAATC 0.977399 -38 ********** Masking position 4 Map Score: 0.283334 Number of sites scoring better than the average of aligned sites = 3 Number in coding regions = 2 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 6 ********** No masking Map Score: 5.42445e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 5.42445e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 5.42445e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0