AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i272_aful_mthe_100.orf -o272_aful_mthe_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG45611 139 Archaeoglobus_fulgidus Motif number 1 CCCTTTATGGTTTCATCTCTGGCCTTTAAGG 1 11 0 TTTATCTCTG 0.996741 -129 GAAACCTGCTTTTTATCTCCGCTATTATACC 1 41 1 TTTATCTCCG 0.99698 -99 GATATCCGAAATAAATCACTGTGCTGGGTAT 1 67 0 ATAATCACTG 0.951728 -73 AAATCGGTCGTGTGATATCCGAAATAAATCA 1 80 0 TGTATATCCG 0.973979 -60 ATGAAAAATCTTAAATTTCTGACTACAAAGT 1 113 1 TTAATTTCTG 0.981723 -27 *** ******* Masking position 6 Map Score: 5.80669 Number of sites scoring better than the average of aligned sites = 123 Number in coding regions = 110 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 ATAGCGGAGATAAAAAGCAGGTTTCCCTTT 1 36 0 TAAAAAGCAG 0.95127 -104 TGTGCTGGGTATAATAGCGGAGATAAAAAG 1 49 0 ATAATAGCGG 0.979761 -91 AGCACAGTGATTTATTTCGGATATCACACG 1 73 1 TTTATTTCGG 0.969022 -67 AGATTTTTCATTAAAATCGGTCGTGTGATA 1 94 0 TTAAAATCGG 0.990365 -46 TGAAAAATCTTAAATTTCTGACTACAAAGT 1 114 1 TAAATTTCTG 0.947491 -26 ********** Masking position 4 Map Score: 3.4766 Number of sites scoring better than the average of aligned sites = 205 Number in coding regions = 178 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 3 TTCATCTCTGGCCTTTAAGG 1 1 0 GCCTTTAAGG 0.991499 -139 AAGCAGGTTTCCCTTTATGGTTTCATCTCT 1 22 0 CCCTTTATGG 0.968875 -118 TCACACGACCGATTTTAATGAAAAATCTTA 1 96 1 GATTTTAATG 0.951683 -44 ********** Masking position 7 Map Score: 0.849832 Number of sites scoring better than the average of aligned sites = 174 Number in coding regions = 159 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 ********** No masking Map Score: -1.82309e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.82309e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.82309e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0