AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i272_aful_mthe_300.orf -o272_aful_mthe_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG10817 83 Archaeoglobus_fulgidus #2 RAG45610 36 Archaeoglobus_fulgidus #3 RAG45611 139 Archaeoglobus_fulgidus Motif number 1 CAGTTGTAAAGAAACAAATTTAGCTGACGG 1 58 0 GAAACAAATT 0.982885 -26 AGGAAAAATATTTAATGATTTA 2 3 1 GAAAAATATT 0.98114 -34 GCAAAAAATAGAAATAAATCATTAAATATT 2 17 0 GAAATAAATC 0.981192 -20 GCAAAAAATAGAAATAAATC 2 27 0 GCAAAAAATA 0.934101 -10 TGTGATATCCGAAATAAATCACTGTGCTGG 3 71 0 GAAATAAATC 0.981192 -69 CGATTTTAATGAAAAATCTTAAATTTCTGA 3 105 1 GAAAAATCTT 0.950322 -35 ********** Masking position 6 Map Score: 7.61645 Number of sites scoring better than the average of aligned sites = 84 Number in coding regions = 57 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 2 GCAAAAAATAGAAATAAATCATTAAATAT 2 18 0 TAGAAATAAT 0.864779 -19 CCTTAAAGGCCAGAGATGAAACCATAAAGGG 3 11 1 CAGAGATAAA 0.994279 -129 GGTATAATAGCGGAGATAAAAAGCAGGTTTC 3 41 0 CGGAGATAAA 0.993107 -99 ATACCCAGCACAGTGATTTATTTCGGATATC 3 67 1 CAGTGATTAT 0.924901 -73 TGATTTATTTCGGATATCACACGACCGATTT 3 80 1 CGGATATACA 0.929871 -60 ACTTTGTAGTCAGAAATTTAAGATTTTTCAT 3 113 0 CAGAAATTAA 0.976381 -27 ******* *** Masking position 6 Map Score: 3.56971 Number of sites scoring better than the average of aligned sites = 238 Number in coding regions = 211 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 3 CCTACTTTTCCACCAATTTTGGTGGTGGCC 1 11 0 CACCAATTTT 0.971611 -73 ATTTATATAGCCCTACTTTTCCACCAATTT 1 22 0 CCCTACTTTT 0.981461 -62 ATAAAGGGAAACCTGCTTTTTATCTCCGCT 3 34 1 ACCTGCTTTT 0.967742 -106 TGCTTTTTATCTCCGCTATTATACCCAGCA 3 47 1 CTCCGCTATT 0.967687 -93 GATATCACACGACCGATTTTAATGAAAAAT 3 92 1 GACCGATTTT 0.966404 -48 ********** Masking position 7 Map Score: 1.81877 Number of sites scoring better than the average of aligned sites = 605 Number in coding regions = 539 Number in noncoding regions = 66 Number of orfs with sites within 600 bp upstream = 62 Fraction of orfs with sites within 600 bp upstream = 0.00995824 Motif number 4 ********** No masking Map Score: -3.95472e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.95472e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.95472e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0