AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i319_aful_mthe_300.orf -o319_aful_mthe_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG50028 105 Archaeoglobus_fulgidus Motif number 1 GATGAGAGGATGATTGAACAAT 1 2 1 ATGAAGGATG 0.992415 -104 ATGATTGAACAATATAAAATGTTTTTCAATG 1 20 1 AATAAAAATG 0.989674 -86 AAGTGAAAGAATGACAAAATGAACATTGAAA 1 43 0 ATGAAAAATG 0.997377 -63 GGTATTTAAAATTAAAAAATGTTTCGTGTAA 1 74 0 ATTAAAAATG 0.995948 -32 **** ****** Masking position 6 Map Score: 6.45899 Number of sites scoring better than the average of aligned sites = 25 Number in coding regions = 17 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 2 GAGAGGATGATTGAACAATATAAAATGTTT 1 14 1 TTGAACAATA 0.903163 -92 ATGAACATTGAAAAACATTTTATATTGTTC 1 26 0 AAAAACATTT 0.965327 -80 GAATGACAAAATGAACATTGAAAAACATTT 1 36 0 ATGAACATTG 0.979366 -70 CGTGTAAAAGTGAAAGAATGACAAAATGAA 1 51 0 TGAAAGAATG 0.928976 -55 CACTTTTACACGAAACATTTTTTAATTTTA 1 69 1 CGAAACATTT 0.985266 -37 CAGAAGATTTCGGTATTTAA 1 96 0 CAGAAGATTT 0.972627 -10 ********** Masking position 5 Map Score: 4.03088 Number of sites scoring better than the average of aligned sites = 460 Number in coding regions = 397 Number in noncoding regions = 63 Number of orfs with sites within 600 bp upstream = 71 Fraction of orfs with sites within 600 bp upstream = 0.0114038 Motif number 3 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0