AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i004_bsub_mtub_300.orf -o004_bsub_mtub_300.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 purE 300 phosphoribosylaminoimidazole carboxylase I Motif number 1 CGTTCGATAATATCGTTGACATTATCCATG 1 21 1 TATCGTTGAC 0.989506 -280 TCGTTGACATTATCCATGTCCGTTGTTAAG 1 33 1 TATCCATGTC 0.99582 -268 ATGTCAGTTTTATCGATCACTTTCCTGCAT 1 149 0 TATCGATCAC 0.988874 -152 TTCTGCGATATATCCATGTCAGTTTTATCG 1 164 0 TATCCATGTC 0.99582 -137 ********** Masking position 7 Map Score: 5.86029 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 30 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 2 ATTTTTGTATCGTTCGATAATA 1 3 1 TTTTGTATCG 0.963346 -298 TGAGGTCGTGTTTTGATTTCATGTTTATCT 1 61 0 TTTTGATTTC 0.973692 -240 ACCATGCCCGGTTTGTATTGCTTCCTCATA 1 216 1 GTTTGTATTG 0.963345 -85 AGCGGGTATTTTTTATTTTCTGAAAACAAA 1 258 1 TTTTATTTTC 0.958906 -43 CTTCTAATGCTTTTGTTTTCAGAAAATAAA 1 269 0 TTTTGTTTTC 0.991855 -32 ********** Masking position 4 Map Score: 3.90459 Number of sites scoring better than the average of aligned sites = 525 Number in coding regions = 453 Number in noncoding regions = 72 Number of orfs with sites within 600 bp upstream = 77 Fraction of orfs with sites within 600 bp upstream = 0.0123675 Motif number 3 CAACGGACATGGATAATGTCAACGATATTA 1 28 0 GGATAATGTC 0.926486 -273 TATAATCTTGGGAATATGGCCCATAAGTTT 1 91 1 GGAATATGGC 0.950221 -210 CCCGGCAACCGTAAATTGCCGGACTATGCA 1 124 1 GTAAATTGCC 0.945779 -177 GTAAATTGCCGGACTATGCAGGAAAGTGAT 1 134 1 GGACTATGCA 0.983838 -167 GACGATACATGTACCATGCCCGGTTTGTAT 1 204 1 GTACCATGCC 0.989841 -97 TTCCTCATAAGTGCAATGCAGAGCGGGTAT 1 237 1 GTGCAATGCA 0.953618 -64 ********** Masking position 7 Map Score: 2.35929 Number of sites scoring better than the average of aligned sites = 638 Number in coding regions = 598 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 4 TGTTTATCTTAACAACGGACATGGATAATG 1 40 0 AACAACGGAC 0.994064 -261 AAGTGATCGATAAAACTGACATGGATATAT 1 157 1 TAAAACTGAC 0.976466 -144 CGCAGAAGCGAACGACTGACGATACATGTA 1 187 1 AACGACTGAC 0.994064 -114 ********** Masking position 5 Map Score: 0.807304 Number of sites scoring better than the average of aligned sites = 24 Number in coding regions = 20 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0