AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i065_bsub_mtub_300.orf -o065_bsub_mtub_300.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 hutP 300 transcriptional regulator #2 hutH 112 histidase Motif number 1 GGCGTTTTTTAAGATGATGC 1 1 1 GGCGTTTTTT 0.896051 -300 TTTTTCGCAAGGCGTTTTATAAAGAGCCAG 1 62 0 GGCGTTTTAT 0.956103 -239 ACGCATATTGAGAGTTAGACAGCGGCGCTT 1 105 1 AGAGTTAGAC 0.794901 -196 GTTAGACAGCGGCGCTTGCCTCCTTGTCTG 1 118 1 GGCGCTTGCC 0.988374 -183 TAGACGATAGGGGGCTATGCGTGAAAACAG 2 27 1 GGGGCTATGC 0.981062 -86 CATACAAAAAGGAGCTATGCTGTGAACTTC 2 56 0 GGAGCTATGC 0.988801 -57 TTTTTGTATGGGCGCTTTACCAAAGTAAAG 2 76 1 GGCGCTTTAC 0.99342 -37 TAAAGAAAAAGGAGTTGGGCTT 2 101 1 GGAGTTGGGC 0.969703 -12 ********** Masking position 6 Map Score: 7.44187 Number of sites scoring better than the average of aligned sites = 1146 Number in coding regions = 1035 Number in noncoding regions = 111 Number of orfs with sites within 600 bp upstream = 77 Fraction of orfs with sites within 600 bp upstream = 0.0123675 Motif number 2 GCATCATCTTAAAAAACGCC 1 1 0 AAAAAACGCC 0.906214 -300 AAGGCGTTTTATAAAGAGCCAGCCGAATGA 1 54 0 ATAAAGAGCC 0.923207 -247 AATACGACTTAGTAAACGCATATTGAGAGT 1 90 1 AGTAAACGCA 0.83268 -211 ATTGAGAGTTAGACAGCGGCGCTTGCCTCC 1 111 1 AGACAGCGGC 0.957363 -190 CGATATCCAGACAAGGAGGCAAGCGCCGCT 1 125 0 ACAAGGAGGC 0.806828 -176 GTGCAATCGCTGAAAAAACCTGTTCTGCTT 1 156 1 TGAAAAAACC 0.729503 -145 AGCGTGACGCAGAAAGCAGAACAGGTTTTT 1 169 0 AGAAAGCAGA 0.939498 -132 GGGCTATGCGTGAAAACAGAAGTTCACAGC 2 38 1 TGAAAACAGA 0.762838 -75 AAGCGCCCATACAAAAAGGAGCTATGCTGT 2 63 0 ACAAAAAGGA 0.896794 -50 CTTTACTTTGGTAAAGCGCCCATACAAAAA 2 76 0 GTAAAGCGCC 0.842331 -37 ACCAAAGTAAAGAAAAAGGAGTTGGGCTT 2 94 1 AGAAAAAGGA 0.960877 -19 ********** Masking position 3 Map Score: 4.93568 Number of sites scoring better than the average of aligned sites = 6521 Number in coding regions = 5762 Number in noncoding regions = 759 Number of orfs with sites within 600 bp upstream = 641 Fraction of orfs with sites within 600 bp upstream = 0.102955 Motif number 3 CAGAAAGCAGAACAGGTTTTTTCAGCGATT 1 160 0 AACAGGTTTT 0.920835 -141 AGCAGAAGTCAAAAGGTTTTTTTATAGTCT 1 225 0 AAAAGGTTTT 0.930199 -76 GTTAATAGTTATCAGAATTTTTAGGAATTG 1 280 1 ATCAGAATTT 0.885111 -21 TATGCGTGAAAACAGAAGTTCACAGCATAG 2 42 1 AACAGAAGTT 0.974902 -71 CGCCCATACAAAAAGGAGCTATGCTGTGAA 2 60 0 AAAAGGAGCT 0.971114 -53 AAAGTAAAGAAAAAGGAGTTGGGCTT 2 97 1 AAAAGGAGTT 0.98598 -16 ********** Masking position 4 Map Score: 6.84983 Number of sites scoring better than the average of aligned sites = 417 Number in coding regions = 329 Number in noncoding regions = 88 Number of orfs with sites within 600 bp upstream = 99 Fraction of orfs with sites within 600 bp upstream = 0.0159011 Motif number 4 ********** No masking Map Score: 1.80068e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.80068e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.80068e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0